ID: 1086989741

View in Genome Browser
Species Human (GRCh38)
Location 11:93289925-93289947
Sequence CAGTTATATCAAAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086989734_1086989741 25 Left 1086989734 11:93289877-93289899 CCCTTGGTCTGTGGTTGGCTCAG No data
Right 1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG No data
1086989735_1086989741 24 Left 1086989735 11:93289878-93289900 CCTTGGTCTGTGGTTGGCTCAGG No data
Right 1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086989741 Original CRISPR CAGTTATATCAAAGGGCAGG AGG Intergenic
No off target data available for this crispr