ID: 1086990948

View in Genome Browser
Species Human (GRCh38)
Location 11:93303526-93303548
Sequence ACCTGTAAGCTGATGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086990948_1086990952 20 Left 1086990948 11:93303526-93303548 CCAAGCAGCATCAGCTTACAGGT No data
Right 1086990952 11:93303569-93303591 CAAGATGAGACCAACTGACTTGG No data
1086990948_1086990949 -10 Left 1086990948 11:93303526-93303548 CCAAGCAGCATCAGCTTACAGGT No data
Right 1086990949 11:93303539-93303561 GCTTACAGGTCCTTCTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086990948 Original CRISPR ACCTGTAAGCTGATGCTGCT TGG (reversed) Intergenic
No off target data available for this crispr