ID: 1086992082

View in Genome Browser
Species Human (GRCh38)
Location 11:93314431-93314453
Sequence TAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086992082_1086992084 4 Left 1086992082 11:93314431-93314453 CCCATATCACTATCAGCATTTTA No data
Right 1086992084 11:93314458-93314480 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086992082 Original CRISPR TAAAATGCTGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr