ID: 1086992164

View in Genome Browser
Species Human (GRCh38)
Location 11:93315259-93315281
Sequence TTCTGTCCTCCTCTTCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086992160_1086992164 -4 Left 1086992160 11:93315240-93315262 CCTCCTTTCCTCCTGGAGGTTCT No data
Right 1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG No data
1086992161_1086992164 -7 Left 1086992161 11:93315243-93315265 CCTTTCCTCCTGGAGGTTCTGTC No data
Right 1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086992164 Original CRISPR TTCTGTCCTCCTCTTCAGTC TGG Intergenic
No off target data available for this crispr