ID: 1086994642

View in Genome Browser
Species Human (GRCh38)
Location 11:93342171-93342193
Sequence ATTTTTCAGCCTACTTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086994641_1086994642 -3 Left 1086994641 11:93342151-93342173 CCTGATTATCTTTGGGGACAATT 0: 1
1: 0
2: 3
3: 12
4: 159
Right 1086994642 11:93342171-93342193 ATTTTTCAGCCTACTTCATATGG 0: 1
1: 0
2: 4
3: 27
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086994642 Original CRISPR ATTTTTCAGCCTACTTCATA TGG Intronic
902692846 1:18120976-18120998 ATTTTCCACCCTATTTCACACGG + Intronic
903096093 1:20975422-20975444 ATTTTTGAGCCTACATGATTGGG + Intronic
903426018 1:23254863-23254885 ATTTTTCAACCTACTACAGAGGG - Intergenic
908015676 1:59831686-59831708 AATTTTCAGACTACAGCATAGGG - Intronic
909782947 1:79570510-79570532 ATTCTTCAGCTGACTTCTTATGG - Intergenic
910079091 1:83317928-83317950 ATTTTTCTGCCTCCTACACAAGG + Intergenic
910764868 1:90771548-90771570 ATATTCCAGCCTATTTCACAGGG + Intergenic
912092075 1:106090929-106090951 ATTTTTGGGCCTCTTTCATATGG - Intergenic
912148913 1:106831940-106831962 ATTTTTCAGCCTATTACATTTGG + Intergenic
916229835 1:162530766-162530788 ATTGTTTAGCTTACTTCCTAGGG + Intergenic
916974470 1:170060954-170060976 AGTTTTCAGCTTTCTACATATGG - Intronic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
921256804 1:213348818-213348840 ATTTATGAGCCTGCTCCATAGGG - Intergenic
921378763 1:214502087-214502109 ATTTTTCAAACCACTTTATAAGG + Intronic
921731488 1:218584685-218584707 TTTTAAAAGCCTACTTCATAAGG - Intergenic
921789402 1:219272350-219272372 ACTTTTCAGCCTGCTTCTTAGGG - Intergenic
924034631 1:239923905-239923927 AGTTTTCAGTCTACTTTACAAGG - Intergenic
1064898403 10:20265405-20265427 ATATTTCAGCTTGCTTCATTTGG + Intronic
1065202031 10:23322164-23322186 ATAATTGTGCCTACTTCATAAGG + Intronic
1066601288 10:37110219-37110241 ATGTTTTATCCTCCTTCATAGGG - Intergenic
1067518821 10:46979105-46979127 ATCTTTCAGCCTTCTCCAAAGGG + Intronic
1067643426 10:48072729-48072751 ATCTTTCAGCCTTCTCCAAAGGG - Intergenic
1068016018 10:51517068-51517090 ATTTGTCAGTCTAATTTATAGGG - Intronic
1068027994 10:51672598-51672620 ATTTTTCTGACTCCTTCATGTGG + Intronic
1070265055 10:74894040-74894062 AAGTTTCAGGCTAATTCATAAGG - Intronic
1072797359 10:98366116-98366138 CTTTTTTACCCTTCTTCATAGGG + Intergenic
1074340219 10:112621033-112621055 ATTTTTCAACAGATTTCATATGG - Intronic
1074913170 10:117930704-117930726 ATTATTCAGCCTACCACCTATGG + Intergenic
1075135136 10:119777841-119777863 AATTTCCACCCTACTTTATAAGG + Intronic
1075299317 10:121307281-121307303 ATTTTTGAGCACACTTCCTAAGG + Intergenic
1077589575 11:3481116-3481138 ATTTTTCAACATAGTTCCTAGGG + Intergenic
1077680356 11:4234632-4234654 TTTTTTCAGTGTAATTCATAAGG - Intergenic
1077681128 11:4241282-4241304 TTTTTTCAGTGTAATTCATAAGG + Intergenic
1077684636 11:4280048-4280070 TTTTTTCAGTGTAATTCATAAGG - Intergenic
1077689768 11:4331209-4331231 TTTTTTCAGTGTAATTCATAAGG - Intergenic
1079974756 11:27077197-27077219 ATTTTTGGTCCTACTTCACAGGG - Intronic
1080415662 11:32067786-32067808 ATTATTTAGCCTACTACAGAGGG - Intronic
1081729412 11:45358983-45359005 ATTGTTCAGCCAAATTCAGAAGG + Intergenic
1082098779 11:48154089-48154111 ATTCTACTACCTACTTCATAAGG - Intronic
1082637474 11:55614103-55614125 ATTCTGCTACCTACTTCATAAGG + Intergenic
1084669559 11:70597051-70597073 ATTATTCAGCTTTGTTCATAGGG - Intronic
1085772929 11:79340807-79340829 ATTTTTCAGCCTACCACACCAGG - Intronic
1086154452 11:83650132-83650154 ATCATTCAGCCTACTGCACACGG - Intronic
1086994642 11:93342171-93342193 ATTTTTCAGCCTACTTCATATGG + Intronic
1087221345 11:95549725-95549747 ATTTTTCAGCCTAAGTAATTGGG - Intergenic
1087738737 11:101863382-101863404 ATTTATCAGCCTAATTCACCAGG + Intronic
1087862378 11:103175882-103175904 ACTTTTTAACCTACTTTATAGGG + Intronic
1088481276 11:110298037-110298059 ATTGTTCAGCCTACCACATCAGG + Intergenic
1088990233 11:114947488-114947510 ATTTTGCAGCCTCCATCTTAAGG + Intergenic
1089917711 11:122174958-122174980 ATCTTTAAGCCTACTTCCTATGG - Intergenic
1090498465 11:127237961-127237983 AATATTCAGCTCACTTCATAGGG - Intergenic
1092000048 12:5024400-5024422 ACTCTGCAGCCTTCTTCATAGGG + Intergenic
1093140266 12:15501894-15501916 ATTTGTCAGCGTACTTCCCATGG + Exonic
1093341850 12:17985708-17985730 ATTATTCTGTCTATTTCATAAGG - Intergenic
1093347872 12:18062456-18062478 ATTTTTGAGGAAACTTCATAGGG - Intergenic
1094306200 12:29022400-29022422 ATTTTGCTTCCTACTTCATCTGG + Intergenic
1094463929 12:30730184-30730206 ATTTTTCAGCCTTTTGCATAGGG - Intronic
1095729713 12:45493321-45493343 TTTTTTCAGCCTACCACAGATGG + Intergenic
1097268520 12:57759657-57759679 GTTTTCCTGTCTACTTCATAGGG + Exonic
1097464132 12:59901635-59901657 ATTTTTCAGCCTTTTTCCTTGGG - Intergenic
1097772635 12:63606035-63606057 ATTTTTCTTCCTAATACATAAGG + Intronic
1098850707 12:75592950-75592972 ATATTTCAGACTATTTCAGACGG - Intergenic
1099607010 12:84815948-84815970 ATTCTTCAGCTTTCTTCATTTGG - Intergenic
1099775839 12:87128457-87128479 AGTGTTCAGTGTACTTCATAGGG - Intergenic
1099799533 12:87440300-87440322 ATTTTTCAGGCTTTTTCATTTGG + Intergenic
1099947177 12:89258037-89258059 TATTTTCAGCCTTCATCATAGGG + Intergenic
1100397998 12:94201497-94201519 ATTTTTCTCCCAACTTCATCAGG + Intronic
1100844214 12:98643314-98643336 ATTTTTTATGCTACTACATATGG - Intronic
1100853843 12:98740754-98740776 ATTTTCCATCCTCCTACATAGGG + Intronic
1101811397 12:108111114-108111136 TTCTTTCTGCCTATTTCATAGGG + Intergenic
1101938227 12:109077238-109077260 ATTTTCCAGCCTATTTTATGAGG - Intronic
1102901717 12:116643904-116643926 ATTTTTCAGCCTACTGCAAGAGG - Intergenic
1104006512 12:124896527-124896549 ATTGTTCAGCCTACCACAGAGGG + Intergenic
1106426785 13:29638093-29638115 ATTTTTCACCCTCTTTCAAAAGG - Intergenic
1106905330 13:34402774-34402796 ATTTTTCAACCTAGTTTGTACGG + Intergenic
1108826981 13:54424105-54424127 ATTTTTCAGGTTACTTCAGGTGG + Intergenic
1110421809 13:75318905-75318927 TTTTTTCAGCTTAGGTCATAAGG - Intronic
1111720402 13:91936587-91936609 ATTATTCAGTCTACCACATAAGG + Intronic
1112443068 13:99439050-99439072 ATTTTTCAGCCTACCACGTGTGG + Intergenic
1112569814 13:100583749-100583771 ATTTGTCAGCATACTTCTTGTGG + Intronic
1112600440 13:100850198-100850220 ATTTTTCAGCTTACCTCAAGGGG + Intergenic
1112969479 13:105242242-105242264 ATTTGTCATGCTATTTCATATGG + Intergenic
1113232543 13:108229872-108229894 ATTTTTAAGCATACCACATATGG + Exonic
1113259800 13:108549086-108549108 ATTATTCTGCCTACAACATATGG - Intergenic
1115903346 14:38179195-38179217 ATTTTTCAGACTACTTCTAAGGG + Intergenic
1116245272 14:42403691-42403713 ATTTTACAGGTGACTTCATATGG - Intergenic
1118691773 14:68346852-68346874 ATTTCTCAGAGTACTTCTTATGG + Intronic
1119590689 14:75884845-75884867 CTTTATCAGGATACTTCATAGGG - Intronic
1120039639 14:79738114-79738136 ATTTTTCAACCTACTGCAGGTGG - Intronic
1123168419 14:106348407-106348429 CTATTTCTGCCTACTTCATATGG + Intergenic
1124630351 15:31333176-31333198 ATAATAGAGCCTACTTCATAGGG - Intronic
1124806099 15:32884599-32884621 ATTATTCTGCCTACCACATATGG + Intronic
1126547976 15:49893828-49893850 ATTGTAAAACCTACTTCATATGG + Intronic
1127877651 15:63124456-63124478 ACTTTTCAGTCTACTTTATTAGG + Intronic
1128328759 15:66742226-66742248 CTTTCTCAGCCTACTTCTCATGG + Intronic
1129098427 15:73234458-73234480 CGTTTCCAGCCTACCTCATAGGG + Intronic
1131897539 15:97049986-97050008 ATATTAATGCCTACTTCATAGGG + Intergenic
1132101950 15:99029809-99029831 AATGTTCAGCCTCCTTCCTAAGG - Intergenic
1133398289 16:5465776-5465798 ATTCCTCAGCCTACTTCATAGGG - Intergenic
1133837286 16:9378354-9378376 ATTTCTCAGCCTAGTTTACATGG - Intergenic
1134275904 16:12775934-12775956 ATTGTTCAGCCTACTGCAGATGG - Intronic
1134304982 16:13023890-13023912 ATTATTCAGCCCACTCCAGATGG + Intronic
1135636567 16:24080931-24080953 ATTTTTCAACCTATTTTATGAGG + Intronic
1137338467 16:47573854-47573876 ATTGCTGATCCTACTTCATAAGG - Intronic
1137896936 16:52223539-52223561 ATTTTTGAGCCTATTTAATGAGG + Intergenic
1139931819 16:70533458-70533480 AATTTGCAGGCTAGTTCATACGG + Intronic
1141452051 16:84111009-84111031 ATTTTTCAGCCTACTGCAGGAGG - Intronic
1143980791 17:10867775-10867797 ATTATTCTACCTACTCCATATGG + Intergenic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1146503843 17:33387533-33387555 ATTGCTCAGCCTACTACATCTGG - Intronic
1148508187 17:48145224-48145246 ATTTTTAAGACTTCTTCATGTGG - Intronic
1149821619 17:59784559-59784581 ATTTTTAAGCCCCCTTCTTAAGG - Intronic
1150840661 17:68602497-68602519 ATGGTTCAGCCTACTACACACGG + Intergenic
1153512177 18:5867961-5867983 ATTTTAATACCTACTTCATATGG + Intergenic
1153800218 18:8662143-8662165 ATTTTCCAGCCTCCTTCTGAAGG - Intergenic
1154095441 18:11410323-11410345 ATTATTCAGCCTACTACAGAGGG + Intergenic
1154143920 18:11850412-11850434 CATTTTCAGCCTACCTCATTAGG + Intronic
1155383844 18:25254872-25254894 ATTTTTCAGACTCTTTCTTAGGG - Intronic
1155464877 18:26122824-26122846 ATTTTGCAGACTTCTTCATGCGG - Intergenic
1156257180 18:35409627-35409649 CTTTGGCAGCCTCCTTCATAAGG - Intergenic
1157221795 18:45833426-45833448 ATGCTTCAGCCTCCTGCATAGGG + Intronic
1160467460 18:79093109-79093131 ATTTTTCAGCTTCCTTATTATGG + Intronic
928553252 2:32395502-32395524 ATTTTGCAGCCTGCCTCATCTGG + Exonic
928810668 2:35220664-35220686 ATTTTTCAGCCTTCTGCATTCGG - Intergenic
928861880 2:35868177-35868199 ATTTTTGAGGAAACTTCATATGG + Intergenic
929442225 2:41973259-41973281 ATTTTTCACCCTCATTCCTAAGG - Intergenic
932778345 2:74542936-74542958 ATTTTTCAACCCACTTCCTCTGG + Intronic
934104599 2:88684041-88684063 ATTTTTTTGCCTACTTTAGATGG + Intergenic
934333974 2:92105627-92105649 ATTCTTCTGCCTAGTTTATATGG - Intergenic
934334627 2:92115175-92115197 ATTTTTCTGCCTAGTTTATATGG - Intergenic
935462235 2:103351584-103351606 ATTTTTCAAAATACATCATATGG - Intergenic
940909565 2:159198324-159198346 ATTATTCAGCCTACCACAAAGGG + Intronic
942051411 2:172144453-172144475 ATTTCTCAGGCTACTTCAGCTGG + Intergenic
942333698 2:174856924-174856946 ATTTCTGAGCCTACTTGATTGGG - Intronic
942655156 2:178207561-178207583 ATTTTTCAGCCAACTGCAGTTGG + Intronic
943002293 2:182343573-182343595 ATTTTGCAGCCTAATTGACAAGG + Intronic
945014826 2:205504186-205504208 CATTTTCAGCCTTCTCCATATGG - Intronic
945344733 2:208700075-208700097 ATCTTTCAGCAGACTTCACATGG - Intronic
945875980 2:215278864-215278886 ATTATACAAGCTACTTCATAGGG + Intergenic
947288597 2:228546189-228546211 ATTCTCCATCCTACTTCACAGGG + Intergenic
948436828 2:237959476-237959498 ATTATTCAGCCTTCCACATATGG + Intergenic
1168740185 20:182384-182406 CTTTTTCAACCTAATTCTTAGGG - Intergenic
1169586535 20:7091867-7091889 TTTTTTCAGCCTACCTCAGATGG + Intergenic
1169859035 20:10132522-10132544 ATTTTTCAGCCTCCTCCAGCTGG - Intergenic
1169884377 20:10382254-10382276 ACTTTTCTGCCTCCCTCATAAGG - Intergenic
1170051733 20:12153371-12153393 ATTTTTCAGAATACTTCATCAGG - Intergenic
1170391026 20:15874732-15874754 ATTTTTCCGCCTACCACATTTGG - Intronic
1170632522 20:18077593-18077615 ATTTTTCAGCCTACCACAGTGGG - Intergenic
1170978927 20:21192729-21192751 CTTTTTTACCCTTCTTCATAGGG + Intronic
1173602568 20:44306524-44306546 ATTATTGATCCTACTTCAGAGGG - Exonic
1173691653 20:44965770-44965792 ATTATTATTCCTACTTCATAAGG - Intergenic
1174060606 20:47830223-47830245 ATTTTTCTGACTATTTCCTAGGG + Intergenic
1174071292 20:47901147-47901169 ATTTTTCTGACTATTTCCTAGGG - Intergenic
1174099801 20:48118591-48118613 ATTTTTCTGACTATTTCCTAGGG + Intergenic
1174148132 20:48466780-48466802 ATTTTTCTGACTATTTCCTAGGG + Intergenic
1175311594 20:58015606-58015628 AAATTGCAGCATACTTCATATGG - Intergenic
1177346636 21:19881728-19881750 ACTTCTAAGCCTATTTCATAAGG - Intergenic
1177364645 21:20117949-20117971 AGTTTTCACGGTACTTCATATGG + Intergenic
1177434813 21:21037626-21037648 AATTTTCAGCCTAATTGTTAAGG + Intronic
1182273949 22:29172793-29172815 ATTATTCAGCCTTTTACATACGG - Intergenic
1182853137 22:33493630-33493652 ATCATACTGCCTACTTCATAGGG - Intronic
1183848369 22:40562413-40562435 ATTATTCTGCCTGCTCCATATGG - Intronic
1184883049 22:47323960-47323982 AGTATTCAGCCTACTTCAGGGGG + Intergenic
1202716516 2_KI270715v1_random:10202-10224 ATTCTTCTGCCTAGTTTATATGG - Intergenic
1202716961 2_KI270715v1_random:16679-16701 ATTTTTCTGCCTAGTTTATATGG - Intergenic
1202728504 2_KI270716v1_random:33941-33963 ATTCTTCTGCCTAGTTTATATGG - Intergenic
1202729275 2_KI270716v1_random:45187-45209 ATTTTTCTGCCTAGTTTATATGG - Intergenic
949314593 3:2737633-2737655 ATTGTTCAGCTTACTTCTTTCGG - Intronic
949407899 3:3733933-3733955 ATTTTTCAACCTACCACACAAGG + Intronic
950983953 3:17340381-17340403 ATATGTGAGCCTACTTCATTGGG - Intronic
951094701 3:18615090-18615112 ATTTCTGATGCTACTTCATACGG - Intergenic
952071388 3:29640918-29640940 ATGATTCTTCCTACTTCATAGGG + Intronic
953453452 3:43023011-43023033 ATTTTTCAGCCTACTACACATGG - Intronic
953705979 3:45230726-45230748 ATTTCTCAGTCTACAACATATGG - Intergenic
953794864 3:45976823-45976845 TTTTTTAAAACTACTTCATATGG - Intronic
953967197 3:47318324-47318346 AGTCTTCAGTCTTCTTCATATGG + Intronic
955434289 3:58884875-58884897 ATTTTACTGCTTACTTCCTAGGG + Intronic
955625381 3:60912945-60912967 ATTTTTCACTCTACTTTAGAGGG + Intronic
956431833 3:69194327-69194349 AATCCTCATCCTACTTCATAAGG - Intronic
956766694 3:72490247-72490269 TTTTTTCATCCTAGTCCATATGG - Intergenic
959096083 3:101957787-101957809 ATTATTCAGCCTACTATACATGG - Intergenic
959898220 3:111629096-111629118 ATTTTTCAGACTTGTTTATATGG - Intronic
962632415 3:137292240-137292262 AATTTTCTGCCTACTTAATTGGG + Intergenic
962990979 3:140577417-140577439 ATTCTTCAGACTATTTGATAAGG + Intergenic
964548055 3:157856943-157856965 ATTTTTCAACCTTCTTCCCAGGG - Intergenic
965889440 3:173492852-173492874 AATTTTCAGCCTAAAGCATAGGG - Intronic
967587826 3:191235996-191236018 ATTTTCCTTCCTCCTTCATATGG - Intronic
967737858 3:192972554-192972576 ATCTTTCAACCTACTGCCTAGGG + Intergenic
967968463 3:194982459-194982481 ATTTTTCAGCCTACCAAAGATGG - Intergenic
969899200 4:10333212-10333234 ACTTTTCAGCTTTCTACATATGG - Intergenic
972139300 4:35937017-35937039 TTTTTTCAGAATATTTCATAAGG + Intergenic
972248223 4:37269038-37269060 ATTTTTAAGCCTAGTTCTTGAGG + Intronic
972683131 4:41326114-41326136 CTTTGTCAGTCTACTTAATAAGG + Intergenic
973026236 4:45275656-45275678 ATTATTCAGCCTACACCATGTGG + Intergenic
973344061 4:49035599-49035621 CTTTTCCAGCTTACTTTATAGGG + Intronic
974234865 4:59167982-59168004 TTTTTTCAGCTTTCTACATATGG + Intergenic
974244022 4:59290544-59290566 TTTTTTCAGTAGACTTCATATGG + Intergenic
978108718 4:104935366-104935388 ATTTTTCAGTTTTCTGCATATGG - Intergenic
978504922 4:109446094-109446116 ATTATTCAGCCTACCACATCAGG - Intronic
978712404 4:111800218-111800240 TTTTCTCAGCCAACTCCATATGG - Intergenic
978896824 4:113898481-113898503 TTTTTTCACACTACTTTATATGG + Intergenic
979636635 4:122962320-122962342 ATTTTGCAGCATATTTCATAAGG + Intronic
980913494 4:139014128-139014150 ATTTTTCAGCAAACTTCAGAGGG + Intergenic
981098167 4:140802906-140802928 ATTATTCAGCCTACCACAGAAGG + Intergenic
981321162 4:143393496-143393518 AAATTACAGCCTACCTCATAGGG + Intronic
983515524 4:168652237-168652259 ATTTTTCAGCATTCTTCTTGGGG - Intronic
983684387 4:170390714-170390736 ATTTTTCAGGCTGCTTCTTCTGG + Intergenic
986318473 5:6608038-6608060 ATTTTTAAACTTACTTCATAGGG - Intronic
986402127 5:7392887-7392909 GTTTTTCATTTTACTTCATATGG + Intergenic
987296806 5:16560522-16560544 ATTTTTCCTCCTTCTTCATTGGG - Intronic
987300843 5:16597076-16597098 ATTTGCCAGCCTACTTCTTCAGG - Intronic
987900080 5:23999729-23999751 ATTTTTCAGCCTATCACAAAAGG + Intronic
988432220 5:31132624-31132646 ATTTTTAAGCCTATCTGATAAGG - Intergenic
988688438 5:33548389-33548411 ATTTTTAACCCTATTTTATAGGG - Intronic
991577926 5:68124137-68124159 ATTTTTCAGACTTATTTATATGG - Intergenic
992004358 5:72462856-72462878 AGTTTTCTGTCTTCTTCATATGG + Intronic
992843969 5:80726268-80726290 AATCTTCATCCTACTCCATATGG + Intronic
993655869 5:90577314-90577336 ATTTTTCAGCTTTCTACATATGG + Intronic
993735674 5:91474529-91474551 ATTCTTCAGTCAATTTCATAGGG + Intergenic
994039030 5:95236927-95236949 ATTTTAAAGCTTACTTCATGAGG - Intronic
994797598 5:104324354-104324376 ATTATTTAGCCTACTACAGAGGG + Intergenic
996330082 5:122318739-122318761 ATTTTCCAGCCTCCTCCTTAAGG - Intronic
997150503 5:131488788-131488810 GTTTTCCTCCCTACTTCATAAGG + Intronic
997373602 5:133381344-133381366 ATTTGTAAGACTAGTTCATATGG - Intronic
998291373 5:140917604-140917626 AGTTTTCAGTCTTCTGCATATGG + Intronic
998435690 5:142106795-142106817 ATTTGTCGGCCTACCACATAAGG - Intergenic
999756561 5:154668981-154669003 ATTTCTCAGCCTACTACAGTAGG + Intergenic
1000702856 5:164474528-164474550 ATTATTCTGCCTACTACACAAGG - Intergenic
1001469768 5:172003446-172003468 AGTTTTCTGCCTCATTCATAAGG + Intronic
1005450151 6:25964063-25964085 ATTTTTCAGTGAACTTCAGAAGG - Intronic
1006090049 6:31623227-31623249 ATATCTCAGCCTTCTTGATAGGG + Intronic
1006727198 6:36208072-36208094 ATTATAGAGCCTACATCATAAGG + Intronic
1009289267 6:61864333-61864355 ATTTTTCAGACTTGTTCATATGG + Intronic
1010174576 6:73012881-73012903 ATGATATAGCCTACTTCATAAGG + Intronic
1010730118 6:79382182-79382204 ATTTTACAGTCTACTTTCTAGGG + Intergenic
1011408930 6:87045600-87045622 TTTTTTCAGCTTACTGCATATGG - Intergenic
1011430155 6:87277211-87277233 ACTTTTAAACTTACTTCATATGG - Intergenic
1012835973 6:104268945-104268967 TTTATTCAGCCTTCTTCAAAAGG - Intergenic
1014207315 6:118670140-118670162 ATTTCCCCACCTACTTCATATGG + Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015381633 6:132576625-132576647 ATTTTCCAGATTACTTCATGTGG - Intergenic
1016922593 6:149310536-149310558 ATTTTCCAGCCTATTACATAAGG - Intronic
1017078037 6:150637956-150637978 ATTTTCCAGCCTACTGAATGAGG + Intronic
1017115232 6:150969582-150969604 ATTCTTCAGACTACTTTACAAGG + Intronic
1020481870 7:8671097-8671119 ATTTTTCAGATTACTTTTTAAGG + Intronic
1020561745 7:9736777-9736799 CTTTTTCAGACTAGTTCCTATGG - Intergenic
1021738613 7:23663145-23663167 ATTATTCAGCCTACCACAGAGGG + Intergenic
1022365596 7:29712620-29712642 ATTTTTCTTCCTAATACATAAGG - Intergenic
1022695922 7:32705531-32705553 ATTTTTCTTCCTAATACATAAGG + Intergenic
1022745858 7:33171397-33171419 ATGTTTCAGCTTTCTACATATGG - Intronic
1022784206 7:33621016-33621038 ATTTTTCATTCTTCTGCATATGG - Intergenic
1022932195 7:35129726-35129748 ATTTTTCTTCCTAATACATAAGG + Intergenic
1024054974 7:45654208-45654230 ATTTTTCTGTCCACTTCATGGGG + Intronic
1024146885 7:46525974-46525996 ATTTTTCAACTTACCTCATTGGG + Intergenic
1024522450 7:50317816-50317838 AGTTTTCAGCCTAATTGAGAGGG + Intronic
1024765481 7:52652798-52652820 ATTTTTCAAGCTGCTGCATATGG - Intergenic
1025234330 7:57223799-57223821 ATTTTTCTGACTATTTCCTAGGG - Intergenic
1025508135 7:61466989-61467011 ATTCTTCTGTCTACTTCTTATGG - Intergenic
1027296861 7:76783202-76783224 ATTTTTCTGCCTCCTACACAAGG + Intergenic
1027902748 7:84138187-84138209 AGTTTTCAGTCTACTCCATCTGG - Intronic
1027993249 7:85391571-85391593 ATTTTTCTGCCTGCTTTATCTGG + Intergenic
1028113261 7:86967984-86968006 ATTTAACAGGCTACTTCATTTGG + Intronic
1030396543 7:108993839-108993861 ATTCTTCAGATTACTGCATAAGG + Intergenic
1031420614 7:121547202-121547224 AGTTTTCAGCCTACATAATCAGG - Intergenic
1031439398 7:121774520-121774542 ATTTGTCAGAATTCTTCATAGGG - Intergenic
1032937405 7:136748864-136748886 TTGTTACAACCTACTTCATAAGG + Intergenic
1033796563 7:144852006-144852028 AATTTTCAGACTACAGCATAGGG - Intergenic
1037796575 8:22000391-22000413 TTTTTTCATCCTAGTCCATATGG + Intronic
1038134943 8:24775219-24775241 ATAATAGAGCCTACTTCATAGGG + Intergenic
1041401921 8:57455331-57455353 ATTTTACAGCTTACTTGTTATGG - Intergenic
1042109207 8:65361403-65361425 ATTGTTCTGCCTACTGCAGATGG + Intergenic
1042255386 8:66797542-66797564 TTTGTTCTGCTTACTTCATAGGG + Intronic
1042882822 8:73513297-73513319 ATTTTTAAGCCTGATTCTTAGGG + Intronic
1042928622 8:73992078-73992100 ATTTTATAGTCTACTTGATAAGG + Intronic
1043276862 8:78408377-78408399 TGTTTTCAGCCTATTTTATAAGG - Intergenic
1043509725 8:80937830-80937852 AATATTCAGCATGCTTCATATGG - Intergenic
1044658924 8:94576800-94576822 ATTTTTTTGCCTAGTTTATAAGG - Intergenic
1046025142 8:108713233-108713255 AGTTTTCAGCCCATTTCCTATGG - Intronic
1046263264 8:111798785-111798807 AATTTTCAGCCAACTTCTTGGGG - Intergenic
1046912354 8:119642567-119642589 ATTGTTTGGCCTAATTCATATGG + Intronic
1047087684 8:121537073-121537095 ATTATTCAGCCTACCACACATGG - Intergenic
1048243747 8:132770594-132770616 ATCTTTCACTCTACTTCTTAAGG - Intergenic
1050360262 9:4823548-4823570 ATTTTGAAGCCAGCTTCATAAGG + Exonic
1052436847 9:28440704-28440726 ATTTTTAATCCTACTTCATAGGG - Intronic
1052459577 9:28745191-28745213 ATTTTTAAGCCTTCTTCCTATGG + Intergenic
1055242991 9:74206908-74206930 ATTTGTCAGCCTCCATAATAAGG - Intergenic
1055432719 9:76260246-76260268 ATTATTCTGCCTACTACAGATGG - Intronic
1055937683 9:81618329-81618351 ATTTGTGGGCCTACTTCAGAAGG - Intronic
1058375803 9:104320241-104320263 ATTTTTCAGCTTCCCACATATGG - Intergenic
1059014082 9:110495214-110495236 GTTATTCAGCCTACTACATGGGG - Intronic
1061462084 9:130747884-130747906 ATTTTTTAGCCTACTACACTTGG + Intronic
1186125876 X:6413355-6413377 ATTATTCAGCCTACCCCAGAGGG - Intergenic
1188381037 X:29492808-29492830 ATTATTCTGCCTACTACATATGG + Intronic
1190722022 X:53156659-53156681 ATCTTTCAGCCTTCACCATAGGG - Intergenic
1193997006 X:88378329-88378351 ATTGTAAAGCCTTCTTCATATGG + Intergenic
1194151346 X:90328079-90328101 ATTTTGCAGACTTCTTTATATGG - Intergenic
1194427934 X:93763014-93763036 ATTATTCAGTCTACTACATTGGG + Intergenic
1194763175 X:97818062-97818084 TTTATTCTGCCTACTTCAGAAGG - Intergenic
1196154194 X:112408554-112408576 CTTTCTCTACCTACTTCATAAGG - Intergenic
1196277713 X:113787291-113787313 ATTACTTAGCCTACCTCATAGGG - Intergenic
1196353074 X:114755672-114755694 ATTTTTCACCCTACTACAACTGG + Intronic
1198429477 X:136551337-136551359 AGTTTTCAGCCTAGTACATAGGG + Intronic
1199376099 X:147110990-147111012 ATTTTGCAGACTTCTTCATGTGG - Intergenic
1200497712 Y:3904833-3904855 ATTTTGCAGACTTCTTTATATGG - Intergenic
1201607531 Y:15803555-15803577 ATTATTCAGCCTACCCCAGAGGG - Intergenic