ID: 1086999283

View in Genome Browser
Species Human (GRCh38)
Location 11:93397297-93397319
Sequence TCTTCTTTGGGCATGGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086999278_1086999283 26 Left 1086999278 11:93397248-93397270 CCATATTCTAGCATCAAAAGAGT 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG 0: 1
1: 0
2: 4
3: 60
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086999283 Original CRISPR TCTTCTTTGGGCATGGTTAA TGG Intronic
902993997 1:20209798-20209820 GCTTCCTTGGGCATGCTTAAGGG + Intergenic
904406970 1:30297829-30297851 TGTTCCTGGGGCATGGTGAAGGG - Intergenic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
905828350 1:41044524-41044546 GCTTGTCTGGGCATAGTTAAAGG + Intronic
905854036 1:41295532-41295554 TGAGCTTTGGGCAGGGTTAATGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912731483 1:112110441-112110463 TCTTCTATGGGTGTGGTTCATGG + Intergenic
912942717 1:114059225-114059247 TGTTCTTTGGGCCTGGTAGATGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
916393834 1:164363633-164363655 TCATCAGTGGGCATGTTTAAAGG + Intergenic
918386200 1:184010645-184010667 TGTTCTTTGGTCATGGTTCTAGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918727393 1:187942972-187942994 TCATCCTTGGGCATGTTTTAGGG - Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
923763147 1:236866341-236866363 TCTTCTATGGGTGTGGTTCATGG - Intronic
1063238534 10:4144826-4144848 TCTTTTTTAGGCTTGGATAATGG + Intergenic
1063245755 10:4216542-4216564 TTTTCTTTCAGGATGGTTAAAGG + Intergenic
1063712064 10:8489109-8489131 TCTTCCCTGGACTTGGTTAAAGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064354016 10:14601833-14601855 TTTTCTTTGGGAATGGTGGAGGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1067133212 10:43584986-43585008 GCTTCTTCTAGCATGGTTAAGGG + Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1070019996 10:72575698-72575720 CCATCTTTGGGCATGGTTTTTGG - Intronic
1070420801 10:76235258-76235280 TCTTCTATGAGCATGATTCATGG + Intronic
1070508806 10:77140853-77140875 GCTCCTTTGGACATGGTTTAGGG + Intronic
1071272131 10:84017628-84017650 ACTTCATTGAGCATGGTTATAGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074874792 10:117605318-117605340 TCCACTTTGGCCATGGTGAATGG + Intergenic
1075545705 10:123352811-123352833 CCTCCTTTTGGAATGGTTAATGG - Intergenic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1079379223 11:19922398-19922420 TCTTCCTTGAGCATGGTTTAGGG + Intronic
1082105711 11:48219104-48219126 TCGTCTATGGACAGGGTTAATGG - Intergenic
1083185272 11:61013993-61014015 CCTTCTTTGGGGATGGTGATGGG - Exonic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087299735 11:96418235-96418257 TCTCCCTTGGTCATGATTAATGG - Intronic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089115007 11:116087738-116087760 TCATCTTTGGGCGTAGTGAAAGG - Intergenic
1090089644 11:123683740-123683762 TATGCCTTGGGCTTGGTTAAGGG + Intergenic
1091027557 11:132155622-132155644 TTTTGTTTGGGCATGTTTTATGG + Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091821664 12:3480050-3480072 TCTTCCATGGACATGGATAATGG + Intronic
1092573576 12:9753229-9753251 TCATTCTTGGGCATGGTTATTGG + Exonic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1095187516 12:39217853-39217875 TCTGCTTTGGACATGGATGAGGG + Intergenic
1095429997 12:42122919-42122941 TCTTCTTTGGGCATGCTATCAGG - Intronic
1097317995 12:58193657-58193679 TCTTGTTTGGCCTTGGTTACAGG + Intergenic
1097487285 12:60220814-60220836 TCTTCTAAGGGCATGCTTATTGG - Intergenic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1098921784 12:76309258-76309280 TCTTCTACGGGCATGGATCATGG + Intergenic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099893536 12:88617801-88617823 TCGTGTTGGGACATGGTTAAGGG - Intergenic
1099948365 12:89271678-89271700 TCTTCTTAGGGGATAGTTAATGG - Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101489198 12:105196294-105196316 CCTTCTTTGGGCATGGTTTGAGG - Intronic
1102297606 12:111749033-111749055 TCTTACTGGGACATGGTTAAAGG - Intronic
1103961735 12:124613198-124613220 TCTGCCATGGGCATGGGTAAGGG - Intergenic
1104139043 12:125968947-125968969 TCTGCCTTGTGCATGGTTACAGG + Intergenic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104991949 12:132630078-132630100 TCTTCTATGCGCACGGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1108181398 13:47843376-47843398 CCATCTATGGGCATGGTTCATGG + Intergenic
1108467958 13:50737610-50737632 TCTTCTATGGGCATGGCTTATGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1112015881 13:95331085-95331107 TCTTGTGTGTGCATGGTTATGGG - Intergenic
1112427441 13:99316040-99316062 TCTGCTTTCGGCAGGGCTAAGGG - Intronic
1112591855 13:100770690-100770712 TCTTCTTTAGGCTTGGCTAATGG + Intergenic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1112978902 13:105356679-105356701 TCTTCTAAGGTCATGGTTCATGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113648976 13:112020703-112020725 TCCTGTATGGGCATGGTTTATGG - Intergenic
1114734261 14:25027401-25027423 TCATTTTTGGGCATGGTTTGTGG - Intronic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1119005108 14:70918374-70918396 TCGTCTGTGGGCAAGGTTGATGG + Intronic
1119179172 14:72593143-72593165 TCTTTCTTGGGCATGGTTGTGGG - Intergenic
1119883383 14:78119999-78120021 CCTTCTGTGGGCATGGTTGGTGG + Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1124950328 15:34312929-34312951 TCTTCTGTGGGCACAGTTCATGG - Intronic
1125297208 15:38216250-38216272 TTTTCTTTGGGTTTGGCTAATGG - Intergenic
1125981349 15:44004572-44004594 TCTTCTATGGGCATGGCTTATGG - Intronic
1126391690 15:48162792-48162814 TTTTATTTGGGCACGGTTGATGG - Intronic
1128866766 15:71120248-71120270 TCTTCTTTGGGCAATCTAAAGGG - Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129493198 15:75949748-75949770 TTTTTTTTGTGCATGGTAAAGGG + Intronic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1133235564 16:4385937-4385959 TCATCTGTGGGCACGGCTAATGG - Intronic
1135958524 16:26976750-26976772 TCTTCATTTGGCATGGGAAATGG + Intergenic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1147384835 17:40075038-40075060 TCTTCCTTGTTCATGGTCAAGGG + Intronic
1148584433 17:48767370-48767392 TCTTCTCTGAGCATGGTGAGAGG + Intronic
1148638622 17:49168414-49168436 CCTTCTTTGGTCTTGGGTAAGGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1148962528 17:51405418-51405440 TCTTTTATGAGCTTGGTTAATGG + Intergenic
1151281165 17:73075242-73075264 TCTTGTTTCTGCATGTTTAAAGG - Intronic
1152974497 18:201256-201278 TCTTTATTGGTCATGGTTAGAGG - Intronic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154096649 18:11422864-11422886 TCTCATATGGGCACGGTTAATGG + Intergenic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155531173 18:26768342-26768364 CCTAATTTGGGCAGGGTTAAGGG - Intergenic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1161168124 19:2799564-2799586 TCTTCTTTCGGCCTGGTTCTTGG + Intronic
1161886135 19:6997269-6997291 TCTGCTTTGGTCATGAATAAAGG + Intergenic
1162731532 19:12721641-12721663 ACTGCTTTGGGCCTGATTAAGGG - Intronic
1164033574 19:21433531-21433553 GCTTCTTCTAGCATGGTTAAGGG + Intronic
1164523280 19:28995136-28995158 TCTTCCTTGGGGATGGGTAGAGG - Intergenic
1164917074 19:32060496-32060518 TCAGCTTTGGGCATTCTTAATGG - Intergenic
1165856468 19:38881486-38881508 TCTTCTCTGGGTATGGGGAAGGG + Exonic
1166951354 19:46430171-46430193 TCTTCTCTGAGATTGGTTAAAGG + Intergenic
1167813037 19:51851906-51851928 TATTCATTGGGGTTGGTTAAAGG - Intergenic
926608702 2:14923606-14923628 TCTTCTTTGGCCTTGTCTAATGG - Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
933548935 2:83749566-83749588 TCTTATTTAGGCATGATTCATGG - Intergenic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
938396349 2:130951536-130951558 TCTTCTATGGGCACAGTTCATGG + Intronic
939209736 2:139158569-139158591 TCTTCTTTTGGAAAGATTAATGG + Intergenic
940102400 2:150056443-150056465 TCTTCTTTAGGTATGCTTCAGGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941750282 2:169128271-169128293 TCTTCTTTAGACACGGCTAAAGG + Exonic
942258981 2:174138411-174138433 TCTTCTATGTGCATCGTTCATGG + Intronic
942921046 2:181374102-181374124 TTTTCTGTGGGCAAGGTTCAGGG - Intergenic
944064590 2:195605350-195605372 TCTTCTTTGGGCAAGGAAAGTGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945017569 2:205535350-205535372 TCTTCTTTTGGCATGGAGAAAGG - Intronic
945189317 2:207169809-207169831 TCTTATTTGGGCACAGTTCATGG - Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169299872 20:4432669-4432691 TGTCTTTTTGGCATGGTTAATGG - Intergenic
1169652004 20:7879470-7879492 TCTTCTTTTGGCATCATTCAGGG + Intergenic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1172131909 20:32661584-32661606 TCTTCCTTGGGCCTGGTTCTGGG + Intergenic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1175458213 20:59131083-59131105 TCTTTTGTGGGCAAGGTTGAAGG + Intergenic
1175692309 20:61074319-61074341 TCTTCTTTGGACAAGATTGAAGG + Intergenic
1177142083 21:17368420-17368442 TCTTCTTTGGGGAGGGGTGAGGG - Intergenic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179091883 21:38273802-38273824 TCTTCTTCCAGCATGGTCAATGG - Intronic
1179269142 21:39836126-39836148 TCCTCTTTGGGCCTGGATACTGG + Intergenic
1180894561 22:19320349-19320371 TCTTTTATGGGCATAGATAAGGG - Intergenic
1181404855 22:22676289-22676311 TCTTATTAGGGGATGCTTAATGG - Intergenic
1181413374 22:22741498-22741520 TCTTATTTGTGGATGCTTAATGG - Intronic
1181418352 22:22777011-22777033 TATTATCTGGGGATGGTTAATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
949900666 3:8812403-8812425 TCATCTTTGGGTAGGGGTAAGGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951507002 3:23458315-23458337 TCTTCTATGGGTGTGGTTCATGG + Intronic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
952808084 3:37376028-37376050 ACTTCTTAGAGAATGGTTAAAGG - Intergenic
953367211 3:42355323-42355345 TCTTCTATGGGTGTGGTTCATGG - Intergenic
953971359 3:47350308-47350330 TCATTTTTGGGCATGGTGTAAGG + Intergenic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
962991406 3:140580686-140580708 GCTTATTTGTTCATGGTTAAAGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
969141838 4:5081881-5081903 ATTTCTTTGGGGTTGGTTAATGG + Intronic
970168265 4:13262693-13262715 TGTTCTTGGGGCATGGGGAAAGG + Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
970733178 4:19133121-19133143 TCATCTTTGAGCATGATAAAGGG - Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973222357 4:47743061-47743083 TATTTTTTGTGCATGGTGAAAGG - Intronic
974270614 4:59646628-59646650 TATTCTATGGGCATGCATAAAGG + Intergenic
974795023 4:66737916-66737938 TTAGCTTTGAGCATGGTTAATGG + Intergenic
975031592 4:69626339-69626361 TTTTTTTTTGCCATGGTTAAAGG - Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
976860871 4:89664704-89664726 GCTAGTTTGGGCATGTTTAAAGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
980377853 4:131975097-131975119 TCATCTTCGGGCTTGGTGAAGGG - Intergenic
980583009 4:134777075-134777097 TCCACCCTGGGCATGGTTAATGG + Intergenic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982148217 4:152421866-152421888 TCTTCTATGGGTGTGGTTCATGG + Intronic
982169975 4:152652049-152652071 TCTTCTGTGAGCATGGTTTCAGG + Intronic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984906233 4:184628829-184628851 GCATCTGTGGGCATGGTCAAAGG - Exonic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986668079 5:10120451-10120473 TCTTCTGTGTGCATGAGTAAAGG - Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
987148418 5:15015149-15015171 TCTCCTTTGTTAATGGTTAAAGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988568811 5:32343866-32343888 TATACTTTGGGGATGGCTAATGG + Intergenic
989240979 5:39202590-39202612 TCTTCTTTGGGCAAGTTGATGGG + Exonic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
990896559 5:60706127-60706149 TCTTCTTTCCTTATGGTTAATGG - Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995366907 5:111372300-111372322 TCTCCTTTGACCATGGTTGAGGG - Intronic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
995929840 5:117426878-117426900 TTTTCTTTGGACATAGTTTATGG + Intergenic
996406135 5:123106037-123106059 TCTTCTTGGAGCCTGGTTGAAGG + Intronic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
998528271 5:142862054-142862076 GATTCTTTGGGCTTGGTTATGGG + Intronic
998994089 5:147851713-147851735 TCTTCATTGGGCATGATTTCTGG - Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1002682181 5:180975210-180975232 TTTTCTTTGGGGGTGGATAAAGG - Intergenic
1002715737 5:181225780-181225802 TCTTCTTTGGACATAGGTAAAGG + Intronic
1003275070 6:4643442-4643464 TCTTCTATGGGCATAGTTCGTGG + Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1007912402 6:45529049-45529071 TCCTTTTAGGGCATGGTTGAAGG - Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1010306385 6:74327931-74327953 CCTTCTTTGGGCATAAATAAAGG - Intergenic
1012304525 6:97636443-97636465 TCTTCTATAGGCATGGTTCGTGG - Intergenic
1012965077 6:105665347-105665369 TCTTCTATGTGCACGGTTCATGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015640710 6:135328486-135328508 TCTTCTATGGCTATGGTTTATGG - Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017635807 6:156441895-156441917 TCTTTTTTGGGCTTAGTCAATGG - Intergenic
1017710100 6:157159939-157159961 TCTTCTTTGCCCATTCTTAAAGG + Intronic
1018149893 6:160927572-160927594 TCTTCTTTGGCCACTCTTAAGGG - Intergenic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1022760171 7:33340487-33340509 ACCTCCTTGGGCATGGTTATGGG + Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1025234163 7:57222675-57222697 TCTTCTTTGTGCATTTTTCAGGG + Intergenic
1025759752 7:64378819-64378841 TCTCCTTTAGGCAGGGTTAAGGG - Intergenic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1034022168 7:147656597-147656619 TCTTCTATGGGCACAGTTAATGG + Intronic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1037526300 8:19727676-19727698 TCCTTTTTGGTCATGGTTGATGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039483040 8:37889606-37889628 TTTTCTTTTGTCCTGGTTAAGGG - Intronic
1040076079 8:43232496-43232518 TCTTCTATGGGCACAGTTCATGG + Intergenic
1040358154 8:46639446-46639468 TCTCCTATAGGCAGGGTTAAGGG - Intergenic
1041378753 8:57229761-57229783 TCTTCTTTGGGCATGTGGAAAGG - Intergenic
1041611275 8:59852513-59852535 TGTGTTTTGGGCATGTTTAAGGG + Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1046131966 8:109976114-109976136 GCTTCATTTGGCATGGTTCAAGG + Intergenic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1050826460 9:9952231-9952253 TGTTCTTTTGTCCTGGTTAAAGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051335327 9:16060682-16060704 CCTTCTGTTGGCATGGTTAGTGG - Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1053438829 9:38096556-38096578 TCTTCTTTGGCCCTGCTTCAGGG - Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056742780 9:89274622-89274644 ATTTCTTTGGGAATGGTTACTGG + Intergenic
1057713469 9:97468298-97468320 TCTTCTTTGGCCATCTTTACAGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1060577606 9:124711477-124711499 CATTCCTTGGGCATGGATAAAGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1186011503 X:5139130-5139152 TCTTCAGTGGTCATGGTGAATGG + Intergenic
1186534079 X:10329266-10329288 CCTTCTTTGGGTTTGTTTAAAGG + Intergenic
1186590189 X:10922194-10922216 GCCTCTTTGGGAATGGGTAAGGG + Intergenic
1186942727 X:14528787-14528809 TCTTTTCTTGCCATGGTTAAAGG - Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188409609 X:29855058-29855080 TCTTCACTGGGCATGGTGAAGGG - Intronic
1188762361 X:34048558-34048580 TCTTCTTTGGGCAGGGCTGATGG + Intergenic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1190141940 X:47854720-47854742 TCTTCTATGCGCATGGTTCGTGG + Intronic
1190929773 X:54937558-54937580 TCTGCTTTGGGAATGTTTGATGG - Intronic
1190992206 X:55563913-55563935 GCTTCTTTGGGGATTTTTAAAGG + Intergenic
1190993427 X:55578325-55578347 TGTTCTTTGCCCATTGTTAATGG - Intergenic
1191023829 X:55892148-55892170 TTTTCTTTAGCCATGATTAAAGG + Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194270790 X:91812220-91812242 TCTTCTTTGAGCAATGTCAAGGG - Intronic
1194577416 X:95629512-95629534 TCTTCTTTGGGCATGAAGAATGG - Intergenic
1195162235 X:102182019-102182041 TCTTCCTTGGGCAAGGGTTAGGG + Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198059179 X:133026805-133026827 TATTCTTTGGGGAAGGTTGATGG + Exonic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic
1200588023 Y:5033653-5033675 TCTTCTTTGAGCAATGTCAAGGG - Intronic
1200844063 Y:7813546-7813568 TCTCCTATAGGCAGGGTTAAGGG + Intergenic
1200854731 Y:7925222-7925244 TCTTCTGTGGGCAGGGCTTAAGG + Intergenic
1200868671 Y:8073908-8073930 TCTCCTATAGGCAGGGTTAAGGG + Intergenic
1200907264 Y:8496735-8496757 TCTTCTTTAGGCTGGGTTTAGGG - Intergenic