ID: 1087009888

View in Genome Browser
Species Human (GRCh38)
Location 11:93503224-93503246
Sequence GCCCCCCCAACCATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087009888 Original CRISPR GCCCCCCCAACCATGGTGAA AGG Intronic
900773966 1:4567743-4567765 GCCCTCACAATCATGGTGGAAGG - Intergenic
901133392 1:6976997-6977019 GGCCTCACAATCATGGTGAAAGG - Intronic
901404266 1:9035790-9035812 GCCTCCCCAGCCATGTGGAATGG - Exonic
903371598 1:22839749-22839771 GGGCCACCAACCCTGGTGAATGG + Intronic
903418873 1:23204047-23204069 GGCCTCACAATCATGGTGAAAGG - Intergenic
903541183 1:24097212-24097234 GCCCCACCAACCCTGCTGAGGGG - Intronic
904036322 1:27561084-27561106 GCCCACCCAACCACAGGGAAAGG - Intronic
905371377 1:37484252-37484274 GTTCCCCCACCCATGGGGAAGGG - Exonic
906017963 1:42599881-42599903 GCCTCCCCAGCCATGTAGAATGG - Intronic
906783225 1:48590930-48590952 GCCCACTCCACCATGATGAATGG - Exonic
906835776 1:49082424-49082446 GGCCTCACAATCATGGTGAAAGG + Intronic
907610519 1:55865289-55865311 GCCTCCCCAGCCATGAAGAATGG + Intergenic
907688241 1:56635361-56635383 GGCCTCACAATCATGGTGAAAGG - Intronic
907814275 1:57902951-57902973 GCCTCCCCAACCATGTGGAATGG - Intronic
908936375 1:69382323-69382345 GGCCCCACAATCATGGTGGAAGG + Intergenic
911331298 1:96528728-96528750 GGCCTCACAATCATGGTGAAAGG - Intergenic
911331641 1:96531264-96531286 GGCCTCACAATCATGGTGAAAGG - Intergenic
913320358 1:117583641-117583663 GCCTCCCCAACCACGTGGAACGG - Intergenic
913490762 1:119377678-119377700 GGCCTCACAATCATGGTGAAAGG + Intronic
918028028 1:180772763-180772785 GGCCTCACAATCATGGTGAAAGG - Intronic
918264899 1:182832701-182832723 GCCTCCCCAGCCATGCTGAATGG - Intergenic
918476633 1:184932170-184932192 GCCACCCCAACCCTGGTCCATGG - Intronic
918619404 1:186584705-186584727 GGCCTCACAATCATGGTGAAAGG - Intergenic
919166323 1:193898890-193898912 GGCCCCACAATCATGGTGGATGG + Intergenic
920707709 1:208266664-208266686 ACCACCCCCACCATGGAGAAGGG + Intergenic
920967283 1:210711621-210711643 GACACCCAAACCAAGGTGAAGGG - Intronic
921078506 1:211719765-211719787 GGCCTCACAATCATGGTGAAAGG - Intergenic
921253163 1:213316264-213316286 GCCTCCCCAGCCATGCTGAATGG + Intergenic
921695434 1:218203820-218203842 GACCCCACAATCATGGTGGAAGG - Intergenic
923754533 1:236779001-236779023 GCCTCCCCAGCCATGAAGAATGG - Intergenic
923965687 1:239135966-239135988 GGCCTCCCAATCATGGTGGAAGG + Intergenic
1064462644 10:15550202-15550224 GTCCTCACAATCATGGTGAAAGG - Intronic
1064581629 10:16798595-16798617 GTCTCCCCAACTATGCTGAATGG + Intronic
1064915295 10:20449853-20449875 GGCCTCACAATCATGGTGAAAGG - Intergenic
1065771922 10:29085832-29085854 GATCCCCCAGCCATGGGGAAAGG + Intergenic
1067292224 10:44951637-44951659 TCCCCGCCAAACATGGTGAAGGG - Intergenic
1068181341 10:53522688-53522710 GGCCTCACAACCATGGTGGAAGG - Intergenic
1069805174 10:71117873-71117895 GCCACTCCAGCCATGCTGAAAGG + Intergenic
1072053453 10:91729468-91729490 GGCCTCACAATCATGGTGAAAGG + Intergenic
1072265892 10:93727543-93727565 GCCCTCACAATCATGGTGGAAGG - Intergenic
1072529651 10:96306981-96307003 GCCTCCCCAGCCATGGGGTATGG + Intronic
1073186071 10:101615715-101615737 GCCCCCACAAAGATGGTGATGGG - Intronic
1074043058 10:109811196-109811218 GGCCTCACAATCATGGTGAAAGG + Intergenic
1074286381 10:112101734-112101756 GGCCCCACAATCATGGTGGAAGG + Intergenic
1074421966 10:113317042-113317064 GGCCCCACAATCATGGTGGAAGG + Intergenic
1075094719 10:119463413-119463435 GGCCTCACAACCATGGTGGAAGG - Intergenic
1075126859 10:119707496-119707518 GGCCTCACAATCATGGTGAAAGG + Intergenic
1075837047 10:125462679-125462701 GCCCCCCCAGCCATGTTGTTTGG + Intergenic
1075895453 10:125990828-125990850 GGCCTCACAACCATGGTGGAAGG + Intronic
1076243223 10:128926160-128926182 GACCTCACAATCATGGTGAAAGG - Intergenic
1076412940 10:130264642-130264664 GGCCCCACAATCATGGTGGAAGG + Intergenic
1076467132 10:130690650-130690672 GCCCTCCCAAGCTTGGTGAGTGG + Intergenic
1076713082 10:132349786-132349808 GCCCACCCAACCATGGGGCAGGG - Intronic
1078629497 11:12989455-12989477 GCCTCCCCAGCCATGCGGAACGG - Intergenic
1079123129 11:17699234-17699256 GCCGTCCCAGCCAGGGTGAAAGG - Intergenic
1080403054 11:31954942-31954964 GCCTCCCCAGCCATGCGGAACGG + Intronic
1080982504 11:37424958-37424980 GACCTCCCAATCATGGTGGAAGG + Intergenic
1081150174 11:39618727-39618749 GGCCTCACAATCATGGTGAAAGG + Intergenic
1081183809 11:40017867-40017889 GACCTCCCAATCATGGTGAAAGG - Intergenic
1081222433 11:40478055-40478077 GGCCTCACAATCATGGTGAAAGG - Intronic
1081291199 11:41327857-41327879 GCCCTCACAATCATGGTGGAAGG - Intronic
1082626644 11:55495287-55495309 GCCTCCCCAACCATGTTGAATGG - Intergenic
1085874062 11:80385219-80385241 GGCCTCACAACCATGGTGTAAGG + Intergenic
1086750875 11:90491748-90491770 GGCCCCACAATCATGGTGGAAGG - Intergenic
1087009888 11:93503224-93503246 GCCCCCCCAACCATGGTGAAAGG + Intronic
1088141351 11:106620732-106620754 GGCCTCACAATCATGGTGAAAGG - Intergenic
1088192204 11:107238650-107238672 GGCCTCACAATCATGGTGAAAGG - Intergenic
1088709683 11:112496664-112496686 GCCTCCCCAGCCATGCTGAGTGG + Intergenic
1088732330 11:112694317-112694339 GCCACACCAACCATGTTGACTGG + Intergenic
1090633917 11:128676445-128676467 GGCCTCACAACCATGGTGGAAGG - Intergenic
1092652098 12:10645974-10645996 GGCCTCCCAATCATGGTGGAAGG - Intronic
1092945945 12:13454098-13454120 GGCCTCACAATCATGGTGAAAGG - Intergenic
1095249997 12:39968138-39968160 GCCTCCCAAACCATGCTGAATGG - Intronic
1095610368 12:44121009-44121031 GGCCCCACAATCATGGTGGAAGG + Intronic
1095939947 12:47719678-47719700 GCCTCCCCAGCCATGTGGAACGG + Intronic
1096477332 12:51916212-51916234 GCCCGCCGGACCATCGTGAATGG + Exonic
1096913463 12:55007467-55007489 GGCCTCACAACCATGGTGGAAGG - Intergenic
1097329453 12:58317703-58317725 GGCCTCACAATCATGGTGAAAGG + Intergenic
1097735951 12:63180592-63180614 GACCTCACAATCATGGTGAAAGG - Intergenic
1098517118 12:71390240-71390262 GGCCACACAATCATGGTGAAAGG + Intronic
1099645369 12:85346939-85346961 GCCTCCCCAGCCATGCAGAATGG - Intergenic
1099990607 12:89716945-89716967 GCCTTCCCAACCATGCTGAACGG + Intergenic
1100047119 12:90396082-90396104 GGCCCCACAATCATGGTGGAAGG - Intergenic
1101415660 12:104506149-104506171 GTCCCTAAAACCATGGTGAATGG - Intronic
1101878144 12:108608867-108608889 GCACACCCACCCATGGGGAAGGG + Intergenic
1102305432 12:111801110-111801132 GGCCTCACAATCATGGTGAAAGG + Intronic
1102639001 12:114349673-114349695 GGCCTCACAATCATGGTGAAAGG - Intergenic
1102875349 12:116444588-116444610 GGCCTCACAATCATGGTGAAAGG - Intergenic
1104170044 12:126271696-126271718 GCCTCCCCAACCATGCTGAATGG - Intergenic
1104783653 12:131436310-131436332 GGCCTCACAATCATGGTGAATGG + Intergenic
1108050137 13:46426925-46426947 GGCCTCACAACCATGGTGGAAGG - Intronic
1108050141 13:46426945-46426967 GCCTCCCCAACCATGTGGAATGG + Intronic
1108163221 13:47664839-47664861 CTCCTCCCAAGCATGGTGAAAGG + Intergenic
1108266484 13:48713922-48713944 GGCCTCACAATCATGGTGAAAGG + Intergenic
1108378138 13:49832725-49832747 GCCTCCCCAGCCATGTAGAACGG + Intergenic
1109187655 13:59289652-59289674 GCCTCCCCAGCCATGCTGAATGG + Intergenic
1109542656 13:63800234-63800256 GGCCTCACAACCATGGTGGAAGG - Intergenic
1109542660 13:63800254-63800276 GCCTCCCCAGCCATGTGGAATGG + Intergenic
1109579452 13:64307896-64307918 GCCTCCCCAGCCCTGCTGAACGG - Intergenic
1109579896 13:64316529-64316551 GCCTCCCCAGCCATGTGGAACGG - Intergenic
1112206872 13:97332967-97332989 TCCCCCACCACCATGGAGAAGGG - Intronic
1112651252 13:101400996-101401018 GCCTCCCCAGCCATGCAGAATGG + Intronic
1112872660 13:103993963-103993985 GGCCTCACAACCATGGTGGAAGG - Intergenic
1113132943 13:107059129-107059151 GCCTCCCCAGCCATGTGGAACGG - Intergenic
1113150369 13:107257001-107257023 GCCTCCCCAGCCATGTGGAATGG - Intronic
1113327374 13:109295051-109295073 GGCCCCACAATCATGGTGGAAGG + Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1114171234 14:20274038-20274060 GCCTCCCCAGCCATGCTGAATGG + Intronic
1114639183 14:24207592-24207614 GGCCTCCCAACCCTGGGGAAAGG + Intronic
1114647784 14:24265155-24265177 GCCTCCCCAGCTATGGTGAATGG + Intergenic
1115807003 14:37062964-37062986 GCCTCCCCAGCCATGTGGAATGG - Intronic
1116079543 14:40155374-40155396 GGCCGCACAATCATGGTGAAAGG + Intergenic
1116286346 14:42977154-42977176 GGCCTCCCAATCATGGTGGAAGG + Intergenic
1119265464 14:73261280-73261302 GCCAGCCCAGCCATGGTGAGTGG + Exonic
1120354020 14:83405495-83405517 GCCTCCCCAGCCATGTGGAACGG - Intergenic
1120384289 14:83824748-83824770 GCCCTCACAATCATGGTGGAAGG + Intergenic
1120612094 14:86654690-86654712 ACCCCCGCAACAATGGCGAATGG - Intergenic
1121483582 14:94296427-94296449 GCCTCTCCAACCATGTGGAACGG + Intergenic
1121499213 14:94420136-94420158 GGCCTCCCAATCATGGTGGATGG - Intergenic
1121965894 14:98305369-98305391 GGCCCCACAATCATGGTGGAAGG - Intergenic
1122583870 14:102790502-102790524 GGCCTCACAATCATGGTGAAAGG + Intronic
1123193909 14:106598166-106598188 GCCTCCCCAGCCATGAAGAACGG + Intergenic
1124511839 15:30334370-30334392 GCCTCCCCAGCCATGTGGAACGG + Intergenic
1124731075 15:32196387-32196409 GCCTCCCCAGCCATGTGGAACGG - Intergenic
1125502423 15:40247961-40247983 GCACCCCCAAACGGGGTGAAAGG - Intronic
1126428795 15:48558424-48558446 ACTCCCCCAAGTATGGTGAAGGG + Intronic
1126937542 15:53728149-53728171 GGCCTCCCAATCATGGTGGAAGG + Intronic
1127044713 15:55013347-55013369 GCCTCCCCAGCCATGTGGAATGG + Intergenic
1130019521 15:80216167-80216189 GCCGCCCCAGCCCTGGAGAACGG - Intergenic
1130894580 15:88160193-88160215 GGCGCCCCAGCCATGGTCAAGGG + Intronic
1130974182 15:88760250-88760272 ACCCCAGCAACCTTGGTGAAGGG - Intergenic
1131954436 15:97716934-97716956 GCCTCCCCAGCCATGTGGAACGG + Intergenic
1135273969 16:21094946-21094968 GGCCTCACAACCATGGTGGAAGG - Intronic
1135995815 16:27247393-27247415 GCCTCCCCAGCCATGCTGAACGG + Intronic
1136014842 16:27389749-27389771 GGCCTCACAATCATGGTGAAAGG + Intergenic
1137591507 16:49696762-49696784 CCCCCCCCACCCAGGGTGGAAGG + Intronic
1137871418 16:51953940-51953962 GTCCCCCTCACCATGGTGACAGG - Intergenic
1138861352 16:60762136-60762158 GGCCTCACAACCATGGTGGAAGG + Intergenic
1139671424 16:68494425-68494447 GGCCTCACAATCATGGTGAAAGG + Intergenic
1140201620 16:72899443-72899465 GCCTCCCCAGCCATGCTGAATGG + Intronic
1140813473 16:78600020-78600042 GGCCTCACAACCATGGTGGAAGG + Intronic
1141313703 16:82939933-82939955 GCCCTCACAATCATGGTGGAAGG + Intronic
1141314679 16:82950586-82950608 GGCCTCACAATCATGGTGAAAGG - Intronic
1141345166 16:83238273-83238295 GGCCTCCCAATCATGGTGGAAGG + Intronic
1144351627 17:14402603-14402625 GCTGCTCCAGCCATGGTGAAAGG + Intergenic
1145727378 17:27143481-27143503 GGCCTCACAATCATGGTGAAAGG - Intergenic
1146452136 17:32982958-32982980 GGCCTCACAATCATGGTGAAAGG + Intronic
1147994336 17:44352914-44352936 GCCCCACCTCCCATGGTGATGGG - Exonic
1149448375 17:56731369-56731391 GGCCTCACAACCATGGTGGAAGG - Intergenic
1149572376 17:57682322-57682344 CCCCCCCCACCCACTGTGAAGGG + Exonic
1151187306 17:72373759-72373781 GCCTCCCCAGCCATGTGGAACGG + Intergenic
1154511060 18:15102840-15102862 GGCCTCCCAATCATGGTGGAAGG + Intergenic
1155622472 18:27795198-27795220 GACCCACCCACCATGGGGAAGGG + Intergenic
1155818499 18:30346717-30346739 GGCCTCACAACCATGGTGGAAGG + Intergenic
1156265928 18:35488495-35488517 GCCACTCCAGCCATGGTAAAAGG - Intronic
1156573962 18:38291406-38291428 GGCCTCCCAACCATGGCGGAAGG - Intergenic
1156859157 18:41816304-41816326 GGCCACACAACCATGGCGAAAGG - Intergenic
1157843200 18:50978389-50978411 GGCCCCACAATCATGGTGGAAGG + Intronic
1158041896 18:53104468-53104490 GGCCTCCCAATCATGGTGGAAGG - Intronic
1158108863 18:53917470-53917492 GGCCTCACAACCATGGTGGAAGG - Intergenic
1158487451 18:57880147-57880169 GCCCTCACAATCATGGTGGAAGG - Intergenic
1159183833 18:64944854-64944876 GCCTCCCCATCCATGCTTAATGG - Intergenic
1160382760 18:78473265-78473287 GGCCCCACAATCATGGTGGAAGG - Intergenic
1161401065 19:4066412-4066434 CCCCCCCCAACCCGGGTGCATGG - Intronic
1164448003 19:28334114-28334136 GCCCTCCAACCCATGGTGGAGGG + Intergenic
1165175140 19:33923661-33923683 GGCCTCACAATCATGGTGAAAGG + Intergenic
1166526607 19:43514391-43514413 GGCCTCCCAATCATGGTGGAAGG - Intronic
1168715597 19:58525295-58525317 GCCCCCACAACCATTGTGCATGG - Intronic
925805472 2:7644146-7644168 GCCTTCCCAACCATGTGGAATGG - Intergenic
925846289 2:8037022-8037044 GCCTCCCCAGCCATGTGGAATGG - Intergenic
929027367 2:37617410-37617432 GGCTCCCCAGCCATGCTGAACGG + Intergenic
930419821 2:51135990-51136012 GGCCTCACAATCATGGTGAAAGG - Intergenic
930606332 2:53497085-53497107 GCCCTGCCTACCATGCTGAAGGG - Intergenic
931715119 2:65022736-65022758 GCGCCCAGAACCATGGTGGAAGG - Exonic
932524177 2:72445563-72445585 GGCCTCACAATCATGGTGAAAGG + Intronic
933251252 2:80031385-80031407 GGCCTCCCAAACATGGTGGAAGG + Intronic
933361733 2:81295351-81295373 GGCCTCTCAACCATGGTGGAAGG - Intergenic
934895075 2:98110977-98110999 GCCCTCACAATCATGGTGGAAGG - Intronic
935917034 2:107965832-107965854 ACCCCCGCAACAATGGTGAAAGG + Intergenic
936874073 2:117167326-117167348 GACCTCACAATCATGGTGAAAGG - Intergenic
938506274 2:131887302-131887324 GGCCTCCCAATCATGGTGGAAGG + Intergenic
938698036 2:133852311-133852333 GCCCTCCCAATCATGGTGGAAGG - Intergenic
939703386 2:145421472-145421494 GCCTCCCCAGCCATGGAGAATGG - Intergenic
940622262 2:156126924-156126946 GGCCCCACAATCATGGTGGAAGG + Intergenic
941123894 2:161562648-161562670 GCCTCCCCAGCCATGTGGAACGG + Intronic
943914103 2:193605780-193605802 GCCTCCCCAGCCATGATGAATGG - Intergenic
945065087 2:205941482-205941504 GGCCCCACAATCATGGTGGAAGG - Intergenic
945127091 2:206524588-206524610 GGCCCCACAATCATGGTGGAAGG + Intronic
945438978 2:209855292-209855314 GCCCCCCTAACCCTGCTGACAGG - Intronic
946440203 2:219688560-219688582 GCCTCCCCAGCCATGCTGCACGG + Intergenic
946472544 2:219975633-219975655 GGCCTCACAATCATGGTGAAAGG - Intergenic
946576980 2:221086471-221086493 GCCTCCCCAGCCATGTGGAATGG - Intergenic
947021088 2:225676522-225676544 GGCCTCACAATCATGGTGAAAGG + Intergenic
947127090 2:226881023-226881045 GCCTCCCCAGCCATGTGGAATGG - Intronic
947598173 2:231427075-231427097 CCCACACCAATCATGGTGAAGGG - Intergenic
1169619663 20:7491312-7491334 GCCTTCCCAGCCATGCTGAATGG + Intergenic
1170600584 20:17838551-17838573 GTCCCTCCAAGCAAGGTGAAGGG - Intergenic
1170750470 20:19140461-19140483 GCCTCCCCAGCCATGTGGAATGG - Intergenic
1171092072 20:22294695-22294717 GCCTCCCCATCCATGTGGAATGG + Intergenic
1172618594 20:36306129-36306151 GCCCCCGCAACCCGGGGGAAGGG - Intergenic
1172720049 20:36993015-36993037 GGCCTCACAATCATGGTGAAAGG - Intergenic
1173412642 20:42827863-42827885 GCATCCCCAGCCATGCTGAACGG + Intronic
1173951730 20:46998683-46998705 ACCACCCTAACCATGGAGAAAGG + Intronic
1174745388 20:53057133-53057155 GGCCCCACAATCATGGTGGAAGG - Intronic
1176689162 21:9882821-9882843 GGCCTCACAATCATGGTGAAAGG + Intergenic
1177243259 21:18489529-18489551 GCCCTCACAATCATGGCGAAAGG + Intergenic
1177489630 21:21805505-21805527 GACCTCACAATCATGGTGAAAGG - Intergenic
1177614544 21:23500082-23500104 GGCCCCACAATCATGGTGGAAGG + Intergenic
1179384298 21:40928203-40928225 GGCCTCACAATCATGGTGAAAGG + Intergenic
1181515278 22:23407296-23407318 GCCCCACCAACAATGAAGAAGGG - Intergenic
1181711650 22:24695327-24695349 GTCCCCACAACCCTGGTGGAGGG + Intergenic
1182709912 22:32314750-32314772 GGCCTCACAATCATGGTGAAAGG + Intergenic
1184115915 22:42422179-42422201 GACCCCCGAACCAGGGTGTACGG + Intronic
1184929380 22:47669804-47669826 GGCCTCACAACCATGGTGGAAGG + Intergenic
949163105 3:905891-905913 GCCTCCCCAGCCATGCTGAATGG - Intergenic
949204054 3:1416984-1417006 GCCTCCCCAATCATACTGAACGG - Intergenic
950843103 3:15987189-15987211 GGCCTCCCAATCATGGTGGAAGG + Intergenic
951168758 3:19513235-19513257 ACCCCCCCAACCATAATAAAAGG + Exonic
951246240 3:20344888-20344910 GCCTCCCCAACCATGAAGAATGG - Intergenic
951902847 3:27673996-27674018 GCCTCCCCAGCCATGCAGAATGG + Intergenic
952838074 3:37621212-37621234 GGCCTCACAACCATGGTGGAAGG - Intronic
954031365 3:47822415-47822437 GGCCTCACAACCATGGTGAAAGG + Intronic
955527268 3:59833966-59833988 GCCTCCCCAGCCATGAGGAATGG + Intronic
955529880 3:59862178-59862200 GACCTCACAATCATGGTGAAAGG + Intronic
955917965 3:63925546-63925568 ACCCCCCCAACCCTGGTCAGTGG + Intronic
958050158 3:88334835-88334857 GTCCTCACAATCATGGTGAAAGG + Intergenic
958175452 3:89990503-89990525 GACCTCACAACCATGGTGGAAGG - Intergenic
958262502 3:91397984-91398006 GCCCTCACAATCATGGTGGAAGG - Intergenic
959104491 3:102050757-102050779 GGCCTCACAATCATGGTGAAAGG - Intergenic
959149841 3:102595406-102595428 GGCCTCACAATCATGGTGAAAGG + Intergenic
959203051 3:103272506-103272528 GCCTCCCCAGCCATGTGGAATGG - Intergenic
959333821 3:105039438-105039460 GCTGCTCCAACCATGGTAAATGG + Intergenic
961050131 3:123738759-123738781 GCCTCCCCAGCCATGTGGAACGG + Intronic
961937986 3:130605797-130605819 GGCCCCACAATCATGGTAAAAGG + Intronic
962488695 3:135869369-135869391 GGCCTCACAATCATGGTGAAAGG + Intergenic
963418234 3:145026677-145026699 GGCCCCACAATCATGGTGGAAGG - Intergenic
963632468 3:147750390-147750412 GGCCCCACAATCATGGTGAAAGG + Intergenic
965028837 3:163336645-163336667 GGCCTCACAATCATGGTGAAAGG + Intergenic
965506294 3:169518936-169518958 GCCTCCCCAGCCATGTGGAATGG + Intronic
966434133 3:179864065-179864087 GGCCACACAATCATGGTGAAAGG - Intronic
966977382 3:185096948-185096970 GAACCCCCAGCCTTGGTGAAAGG + Intronic
968548183 4:1209212-1209234 GGGCCGCCAACCGTGGTGAACGG - Intergenic
970135371 4:12916209-12916231 GGCCTCACAATCATGGTGAAAGG - Intergenic
970351548 4:15206606-15206628 GCCTCCCCAGCCATGCAGAATGG + Intergenic
970604217 4:17664435-17664457 GCCTCCCCAAGCATGCTGCAAGG + Intronic
971112679 4:23606485-23606507 GCCCTCACAATCATGGTGAAAGG - Intergenic
971608951 4:28696525-28696547 GGCCTCACAATCATGGTGAAAGG - Intergenic
971958294 4:33452340-33452362 GCCTCCCCAGCCATGTGGAACGG + Intergenic
973213179 4:47638642-47638664 GGCCCCACAATCATGGTGGAAGG - Intronic
974675706 4:65086116-65086138 GCCCTCACAATCATGGTGGAAGG + Intergenic
974876257 4:67706812-67706834 GCCTCCCCAGCCATGCGGAACGG - Intergenic
975582046 4:75915680-75915702 CCCCCCCAAAGCATGGTGTAAGG - Intronic
977030358 4:91875413-91875435 GGCCTCACAATCATGGTGAAAGG - Intergenic
977041321 4:92023506-92023528 GGACCCACAACCATGGTGAAAGG + Intergenic
978580784 4:110229321-110229343 GCCCTCACAATCATGGTGGAAGG + Intergenic
979045582 4:115858530-115858552 GCCTCCCCAGCCATGTGGAATGG - Intergenic
979162363 4:117479681-117479703 GCCTCCCCAGCCATGTGGAACGG - Intergenic
979327724 4:119399205-119399227 GACCTCACAATCATGGTGAAAGG + Intergenic
980161774 4:129172893-129172915 GCCTCCCCAGCCATGCGGAACGG - Intergenic
980872277 4:138624388-138624410 TCTACCCCAACCATGGTTAAAGG - Intergenic
981308225 4:143268776-143268798 GGCCTCACAATCATGGTGAAAGG - Intergenic
981829847 4:148986811-148986833 GGCCTCACAATCATGGTGAAAGG - Intergenic
983164444 4:164458535-164458557 GGCCACACAATCATGGTGAAAGG - Intergenic
983245475 4:165282927-165282949 GACCTCACAATCATGGTGAAAGG + Intronic
984876767 4:184375768-184375790 GCCTCCCCAGCCATGTGGAACGG - Intergenic
985802931 5:2017554-2017576 GCCTCCCCAGCCATGCAGAACGG + Intergenic
985860992 5:2470726-2470748 GACCTCACAATCATGGTGAAAGG + Intergenic
986267165 5:6200766-6200788 GGCCTCACAATCATGGTGAAAGG - Intergenic
986311146 5:6551940-6551962 GCCCCCGCCCCCATGCTGAAGGG + Intergenic
986511035 5:8506468-8506490 GGCCTCCCAATCATGGTGGAAGG - Intergenic
986715877 5:10523314-10523336 GGCCTCCCAATCATGGTGGAAGG + Intergenic
986807333 5:11320582-11320604 GGCCTCACAACCATGGTGGAAGG + Intronic
987427683 5:17792324-17792346 GCCTCCCCAGCCATGTGGAACGG + Intergenic
987568789 5:19628235-19628257 GCCCCCACAATCATGGTGGCAGG - Intronic
988033118 5:25791800-25791822 GACCCCACAATCATGGTGGAAGG - Intergenic
989753557 5:44923649-44923671 GCCCTCACAATCATGGTGGAAGG - Intergenic
990481292 5:56213982-56214004 GGCCTCACAATCATGGTGAAAGG + Intronic
992517521 5:77510161-77510183 GGCCTCCCAATCATGGTGGAAGG + Intronic
994431168 5:99662964-99662986 GGCCTCCCAATCATGGTGGAAGG - Intergenic
994764408 5:103899161-103899183 GCCCTCACAATCATGGTGGAAGG - Intergenic
995089222 5:108153104-108153126 GGCCTCACAATCATGGTGAAAGG - Intronic
995366906 5:111372297-111372319 TCTCCCTCAACCATGGTCAAAGG + Intronic
995875185 5:116782499-116782521 GCCCTCACAATCATGGTGGAAGG + Intergenic
996356368 5:122600340-122600362 GGCCTCACAATCATGGTGAAAGG + Intergenic
996356561 5:122601795-122601817 GCCTCCCCAGCCATGAGGAATGG - Intergenic
998455899 5:142272826-142272848 GGCCTCACAACCATGGTGGAAGG - Intergenic
998583380 5:143403349-143403371 CTCCCCCCACCCATGGAGAAAGG - Exonic
998914698 5:147001148-147001170 GCCCCACCCACCCTGGTGATTGG - Intronic
1000102997 5:158034667-158034689 GCCTCCCCAGCCATGTGGAACGG + Intergenic
1000357734 5:160417050-160417072 GGCCTCACAAACATGGTGAAAGG - Intronic
1000741351 5:164973851-164973873 GGCCTCACAATCATGGTGAAAGG - Intergenic
1001088342 5:168718084-168718106 GACCTCCCAACCATGGTCCAGGG - Intronic
1001361668 5:171091803-171091825 GGCCTCACAATCATGGTGAAAGG - Intronic
1001380607 5:171304224-171304246 GCCCCCCACCCCATGGAGAAAGG + Intergenic
1005425833 6:25701616-25701638 GTCCCCCCCACCCTGGTGACTGG - Exonic
1007116074 6:39344261-39344283 GGCCTCACAATCATGGTGAAAGG - Intronic
1007203387 6:40130106-40130128 GCCCCCACAAAAATGCTGAAGGG + Intergenic
1007986322 6:46210669-46210691 GCCTTCCCAGCCATGTTGAATGG + Intergenic
1008283790 6:49625840-49625862 GGCCTCACAATCATGGTGAAAGG + Intronic
1009726198 6:67538254-67538276 GGCCTCCCAATCATGGTGGAAGG - Intergenic
1010076591 6:71805012-71805034 GACCTCACAATCATGGTGAAAGG - Intergenic
1010163458 6:72887234-72887256 GGCCTCACAATCATGGTGAATGG + Intronic
1010764976 6:79768866-79768888 GACCTCACAATCATGGTGAAAGG + Intergenic
1010879960 6:81154840-81154862 GACCTCCCAATCATGGTGGAAGG + Intergenic
1011536475 6:88381427-88381449 GCTCCCCCAACCCTGGTGATGGG + Intergenic
1011905853 6:92366486-92366508 GGTCTCACAACCATGGTGAAAGG + Intergenic
1012127669 6:95451559-95451581 GGCCTCACAATCATGGTGAAAGG - Intergenic
1012767523 6:103387340-103387362 GGCCTCACAATCATGGTGAAAGG + Intergenic
1013354354 6:109334079-109334101 GGCCTCACAATCATGGTGAAAGG - Intergenic
1013726129 6:113097906-113097928 GGCCTCACAACCATGGTGGAAGG + Intergenic
1014400723 6:120986855-120986877 GGCCTCACAACCATGGTGGAAGG + Intergenic
1015901939 6:138076330-138076352 GGCCTCACAATCATGGTGAAAGG - Intergenic
1016177718 6:141100200-141100222 GGCCTCACAATCATGGTGAAAGG - Intergenic
1016556201 6:145341233-145341255 GGCCTCACAATCATGGTGAAAGG + Intergenic
1016659934 6:146566635-146566657 GGCCTCACAATCATGGTGAAAGG - Intergenic
1016712711 6:147191953-147191975 GCCTCCCCAGCCATGTGGAATGG - Intergenic
1017313264 6:152999746-152999768 GGCCTCCCAATCATGGTGGAAGG - Intronic
1018091775 6:160351771-160351793 ACCCCTCCCACCATGGTGCAAGG - Intronic
1020742410 7:12038828-12038850 GCCTCCCCACCCATGTGGAATGG - Intergenic
1020919054 7:14238387-14238409 GCCTCCCCAGCCATGTGGAATGG + Intronic
1021096213 7:16538880-16538902 GCCTCCCCAGCCATGTGGAATGG + Intronic
1022976147 7:35558534-35558556 GCCTCCCCAGCAATGCTGAACGG + Intergenic
1023060636 7:36322677-36322699 GGCCTCACAATCATGGTGAAAGG - Intergenic
1024684786 7:51733654-51733676 GGCCTCACAACCATGGTGGAAGG + Intergenic
1026457055 7:70581723-70581745 GCTCCCCAAACCTTGGTGAATGG - Intronic
1026616527 7:71909951-71909973 GGCCTCCCAATCATGGTGTAAGG + Intronic
1027670122 7:81086428-81086450 GGCCTCACAACCATGGTGACAGG + Intergenic
1027881468 7:83843573-83843595 GCCTCCCCAGCCATGCAGAACGG + Intergenic
1027881615 7:83845771-83845793 GGCCTCACAACCATGGTGGAAGG + Intergenic
1028027117 7:85857692-85857714 GGCCTCACAATCATGGTGAAAGG - Intergenic
1029047345 7:97644408-97644430 GGCCTCACAATCATGGTGAAAGG - Intergenic
1029903701 7:104069663-104069685 GCCTCCCCAGCCATGTGGAATGG - Intergenic
1030412933 7:109204436-109204458 GCCCTCACAATCATGGTGGAAGG + Intergenic
1030574667 7:111271246-111271268 GCCTCCCCAGCCATGCTGAACGG + Intronic
1030619929 7:111777853-111777875 GGCCTCACAATCATGGTGAAAGG - Intronic
1032364701 7:131287976-131287998 GCCTCCCCAGCCATGTGGAACGG + Intronic
1032417656 7:131749352-131749374 GGCCTCCCAATCATGGTGGAAGG + Intergenic
1032696400 7:134340225-134340247 GGCCTCACAATCATGGTGAAAGG + Intergenic
1032780610 7:135162514-135162536 GGCCTCACAATCATGGTGAAAGG + Intronic
1035049035 7:155987880-155987902 GCCCTCACAGCCATGGTGATTGG - Intergenic
1035371643 7:158382941-158382963 ACACCCCCAACCATGGTCCATGG + Intronic
1035651031 8:1264991-1265013 GCCCTCACAATCATGGTGGAAGG - Intergenic
1035825262 8:2638287-2638309 GGTCTCACAACCATGGTGAAGGG + Intergenic
1035847172 8:2877890-2877912 GGCCTCACAATCATGGTGAAAGG + Intergenic
1036086842 8:5621862-5621884 GGCCTCACAATCATGGTGAAAGG + Intergenic
1036921665 8:12861640-12861662 GGCCCCACAATCATGGTGGAGGG + Intergenic
1037178515 8:15974986-15975008 GCCTCCCCAGCCATGCTGAATGG + Intergenic
1037216367 8:16456966-16456988 GCCTCCCCAGCCATGCAGAACGG - Intronic
1038274417 8:26108489-26108511 GGCCTCACAATCATGGTGAAAGG - Intergenic
1038420009 8:27427900-27427922 CCCACCCCAACCAGGGTGCATGG - Intronic
1039407267 8:37324077-37324099 GCCTCCACACCCATGCTGAATGG - Intergenic
1039734468 8:40315836-40315858 GCCCTCACAATCATGGTGGAAGG + Intergenic
1040932236 8:52747393-52747415 GCCCCCCCACCCATGTCTAAAGG + Intergenic
1041042291 8:53859737-53859759 GCCCTCACAATCATGGTGGAAGG + Intronic
1044017184 8:87058666-87058688 GCCACTCCAGCCATGGTTAAAGG - Intronic
1044234109 8:89810089-89810111 GCCTCCCCAGCCATGCTGAATGG + Intergenic
1044279598 8:90340112-90340134 GCCTCCCCAGCCATGTGGAATGG + Intergenic
1044282737 8:90375591-90375613 GCCTCCCCAGCCATGTGGAATGG - Intergenic
1044282754 8:90375700-90375722 GCCTCCCCAGCCATGTGGAATGG - Intergenic
1046146961 8:110172792-110172814 GGCCTCACAATCATGGTGAAAGG - Intergenic
1046176434 8:110581830-110581852 GGCCTCACAACCATGGTGGAAGG + Intergenic
1046232194 8:111372778-111372800 GGCCCCACAATCATGGTGGAAGG - Intergenic
1046243605 8:111531204-111531226 GGCCTCACAATCATGGTGAAAGG + Intergenic
1047642138 8:126832248-126832270 GCCTCCCCAGCCATGAGGAACGG - Intergenic
1049279169 8:141735574-141735596 GGCCACCCTGCCATGGTGAAAGG + Intergenic
1049290268 8:141797988-141798010 GACCCTCCAGCCACGGTGAAGGG - Intergenic
1049338952 8:142101626-142101648 TCCCCCCCAACCCTGGGAAAGGG - Intergenic
1049538224 8:143192708-143192730 GGCCTCACAACCATGGTGGAAGG + Intergenic
1050043215 9:1516987-1517009 GCCTCTCCAGCCATGCTGAATGG + Intergenic
1050938315 9:11426005-11426027 GCCTCCCCAGCCATGTGGAATGG - Intergenic
1051421977 9:16897784-16897806 GCCTCCCCAGCCATGTGGAATGG - Intergenic
1052282857 9:26752936-26752958 GGCCTCACAATCATGGTGAAAGG - Intergenic
1053780164 9:41599075-41599097 GGCCTCACAATCATGGTGAAAGG - Intergenic
1054168106 9:61809232-61809254 GGCCTCACAATCATGGTGAAAGG - Intergenic
1054669424 9:67771586-67771608 GGCCTCACAATCATGGTGAAAGG + Intergenic
1055579477 9:77692387-77692409 GGCCTCACAACCATGGTGGAAGG + Intergenic
1056035741 9:82603086-82603108 GGCCTCCCAATCATGGTGGAAGG + Intergenic
1058179546 9:101779884-101779906 GGCTTCCCAACCATGGTGGAAGG - Intergenic
1059599694 9:115763242-115763264 GGCCTCACAATCATGGTGAAAGG - Intergenic
1061513735 9:131076512-131076534 CCTCCCCCAGCCATGGTGACTGG - Intronic
1061977929 9:134081496-134081518 GGCCTCACAACCATGGTGGAAGG - Intergenic
1062005748 9:134237662-134237684 GCCACCCCCACCATGGAGCAGGG - Intergenic
1062570242 9:137181637-137181659 GCGCCCCCCACACTGGTGAAAGG + Intronic
1062684575 9:137803984-137804006 GACCCCCCAGCCACGCTGAAGGG - Intronic
1062757110 9:138305761-138305783 GGCCTCACAACCATGGTGGAAGG - Intergenic
1186609464 X:11124834-11124856 GGCCTCACAATCATGGTGAAAGG - Intergenic
1187331536 X:18344686-18344708 GGCCTCACAATCATGGTGAAAGG - Intronic
1188171407 X:26932244-26932266 GGCCTCACAATCATGGTGAAAGG + Intergenic
1188391780 X:29630151-29630173 GCCCTCCCTCACATGGTGAAGGG + Intronic
1188429515 X:30090281-30090303 GCCCCCCCCACAATGCTGATGGG - Intergenic
1188587795 X:31799306-31799328 GCCTCCCCAGCCATGCAGAATGG - Intronic
1189649487 X:43174163-43174185 GCCTCCCCAGCCGTGCTGAACGG - Intergenic
1192132747 X:68568272-68568294 GGCCTCACAATCATGGTGAAAGG + Intergenic
1192289367 X:69776504-69776526 GGCCTCACAATCATGGTGAAAGG - Intronic
1192935019 X:75850223-75850245 GCCTCCCCAGCCATGTGGAACGG - Intergenic
1193057484 X:77168852-77168874 GCCCCCCCAGCCCTGGCAAACGG + Intergenic
1193543186 X:82795890-82795912 GGCCTCACAATCATGGTGAAAGG - Intergenic
1194496472 X:94622293-94622315 GCCCTCCCAGCCATGTGGAATGG - Intergenic
1194522363 X:94934967-94934989 GCCTCCCCAGCTATGCTGAATGG + Intergenic
1197088533 X:122509293-122509315 GTCTCCCCAGCCATGCTGAACGG - Intergenic
1197371930 X:125636983-125637005 GCCCCGTCAACCTTGGTGAGTGG + Intergenic
1197759366 X:130016650-130016672 GCCCCCCAACCAGTGGTGAAAGG - Intronic
1198444993 X:136704541-136704563 GCCTCCCCAGCCATGTGGAATGG - Intronic
1198796899 X:140406827-140406849 GGCCTCACAATCATGGTGAAAGG - Intergenic
1199240898 X:145546228-145546250 GGCCTCACAACCATGGTGGAAGG + Intergenic
1199795014 X:151186149-151186171 GGCCTCACAACCATGGTGGAAGG + Intergenic
1199869925 X:151889103-151889125 GGCCTCACAATCATGGTGAAAGG - Intergenic
1201674481 Y:16563947-16563969 GGCCTCACAATCATGGTGAAAGG + Intergenic