ID: 1087011742

View in Genome Browser
Species Human (GRCh38)
Location 11:93520834-93520856
Sequence CGTGACATGCTGAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087011742_1087011746 21 Left 1087011742 11:93520834-93520856 CCTTTCACCTTCAGCATGTCACG 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1087011746 11:93520878-93520900 AAGTGCACAGTGGTGCTGCTAGG 0: 1
1: 0
2: 1
3: 20
4: 184
1087011742_1087011745 11 Left 1087011742 11:93520834-93520856 CCTTTCACCTTCAGCATGTCACG 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1087011745 11:93520868-93520890 ACTTCGTTCTAAGTGCACAGTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087011742 Original CRISPR CGTGACATGCTGAAGGTGAA AGG (reversed) Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901833957 1:11911659-11911681 AGTGACTTGCTAAAGGTCAAAGG - Intergenic
903337424 1:22634478-22634500 CTTGCCATGATGCAGGTGAAGGG - Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
921297793 1:213721240-213721262 CATCACATGCTGAAGAAGAAGGG - Intergenic
1063151340 10:3339383-3339405 TGTGACATGGTGGAGGTTAATGG - Intergenic
1070381650 10:75885456-75885478 CATGTCATGCTTAAGCTGAAAGG - Intronic
1070389710 10:75958845-75958867 GGTGGAAGGCTGAAGGTGAAAGG + Intronic
1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG + Intronic
1078914931 11:15770282-15770304 GGTGACATGCTTGAAGTGAATGG - Intergenic
1083870758 11:65487065-65487087 CGTGACCTGCTGAAGGTCCCAGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087183736 11:95163332-95163354 CGTGACTTGCTGAATCAGAATGG - Intergenic
1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG + Intronic
1089969246 11:122679168-122679190 CTGGACATGTTGAGGGTGAAGGG + Intronic
1091631998 12:2169046-2169068 TGTGTCATGCTGAAGGCGAGCGG - Intronic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1095781652 12:46066954-46066976 AGTGGCATGGTGAAGGTGAAAGG - Intergenic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1098626249 12:72673433-72673455 CGTGACATGCTGAAACTGCCTGG - Intergenic
1099490406 12:83282113-83282135 CGTCACATGATAAAGGAGAAAGG + Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1102150470 12:110686371-110686393 AGTTACATGCTGAGGGTGCAAGG + Intronic
1102884527 12:116511506-116511528 CGTGCCCTGCTGAAAGTCAAGGG - Intergenic
1106217412 13:27715522-27715544 AGTGACCTGCTGAAGGGGAGAGG + Intergenic
1108265775 13:48707245-48707267 GGTGACATGCAGAAGCCGAAAGG - Exonic
1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG + Intergenic
1112222179 13:97502130-97502152 GGTGATATGCTGAACGGGAATGG + Intergenic
1113759373 13:112836995-112837017 CGTGACCTGCTGAGGGTGGGGGG - Intronic
1113883930 13:113647447-113647469 CATGCCATGCTGAAGGTCAGAGG - Intergenic
1118371827 14:65144185-65144207 CATGACAGGCTGCAGTTGAAAGG - Intergenic
1120957673 14:90097300-90097322 CTTAACATGGTGAAGGTCAAAGG + Intronic
1122883698 14:104701216-104701238 CGTGCCATGCTGAGGGTTAGGGG - Intronic
1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG + Intronic
1130847688 15:87762505-87762527 CATGACTTGGTGAAGATGAAAGG + Intergenic
1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG + Intergenic
1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG + Intronic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1145918048 17:28588267-28588289 CATGGCATGCTGATGGAGAATGG + Intronic
1149311864 17:55402234-55402256 AGTGAAATTCTGAAGATGAATGG + Intronic
1152509119 17:80773231-80773253 GGTGACAAACTGCAGGTGAAGGG - Intronic
1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG + Exonic
1158374719 18:56849965-56849987 TGTGTCATGGTGAATGTGAAGGG - Intronic
1162762701 19:12897776-12897798 CGAGACATGCTGGGGGGGAATGG + Exonic
1163299686 19:16436267-16436289 TGTGACAGTCTGAAAGTGAAGGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
925913183 2:8586652-8586674 CTGGACATCCTGAAGGGGAATGG - Intergenic
926888321 2:17617760-17617782 CCTGACAAGCTGAGGATGAACGG - Intronic
927219349 2:20692849-20692871 GGTGTCATGCTGAGAGTGAAAGG + Intronic
928293432 2:30060562-30060584 CATGCCATGCTGCAGGGGAATGG - Intergenic
930203600 2:48566887-48566909 CGTTACAGGCTGAAGTTGAAAGG + Intronic
942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG + Intergenic
942339515 2:174929171-174929193 TTTGGCATGCTGAAGGTTAATGG - Intronic
944294625 2:198048541-198048563 CCAGTCATGCAGAAGGTGAAGGG + Intronic
945192113 2:207199435-207199457 GATGAGATGCTGAAAGTGAAAGG - Intergenic
1171133198 20:22674075-22674097 TATGACATCCTGAAGCTGAAGGG + Intergenic
1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG + Intronic
1172208934 20:33184134-33184156 CGACACGTGCTGAAGGTGATGGG + Intergenic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175229497 20:57464775-57464797 AGTGACACGCTCAAGGTCAATGG - Intergenic
1175229507 20:57464865-57464887 AGTGACGTGCTCAAGGTCAATGG - Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1178158553 21:29883678-29883700 TGTGACATTCTGAATGGGAATGG + Intronic
1178730330 21:35096176-35096198 CTTGACATGCTTATGTTGAAGGG - Intronic
1183282412 22:36938649-36938671 AGTGATTTGCTGAAGGTCAAGGG - Exonic
949422013 3:3875707-3875729 CTTGAAATGTTAAAGGTGAATGG - Intronic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
952196907 3:31085372-31085394 TGAGACACGCTGAAAGTGAAAGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG + Exonic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
963901472 3:150737095-150737117 CGTGATATGGTGAAGGGGCATGG + Intergenic
966750610 3:183318060-183318082 CGGGACAAGCTGCAGGTGAGCGG - Exonic
969892960 4:10276683-10276705 AGTGACATGCTCTAGGTTAATGG - Intergenic
971723827 4:30282551-30282573 AGAGACATGATGAAGATGAAGGG - Intergenic
983316370 4:166137309-166137331 GGTGACTGGATGAAGGTGAATGG - Intergenic
985948098 5:3202231-3202253 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948110 5:3202295-3202317 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948122 5:3202359-3202381 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948134 5:3202423-3202445 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948145 5:3202487-3202509 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948157 5:3202551-3202573 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG + Intronic
990408472 5:55516133-55516155 GGTGACATGTTGAAGGTGTAGGG - Intronic
991184269 5:63788998-63789020 CATGACATCCTGCAGGGGAAAGG - Intergenic
1007360297 6:41350737-41350759 CGTGACCTGTTGAAGGTGGCAGG - Exonic
1007875032 6:45088285-45088307 CATGACATGCTAAAGCAGAAGGG + Intronic
1013413260 6:109901198-109901220 GGTGATACGCTGATGGTGAAAGG + Intergenic
1014414976 6:121172763-121172785 CGTCACATGATAAAGGAGAAAGG - Intronic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1017550884 6:155506063-155506085 CGTGCCAAGATGAAGGTGGAGGG + Intergenic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1029144664 7:98437210-98437232 CATGACCTGCTGAAGGTGACAGG + Intergenic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1031972421 7:128074339-128074361 CGTGAGAGGCTGAAATTGAAGGG + Intronic
1035939029 8:3875435-3875457 AGTGAGATGATGTAGGTGAATGG + Intronic
1038718990 8:30016399-30016421 AGTGACTTGCCGAAGCTGAAAGG + Intergenic
1039506349 8:38055162-38055184 CGTGAGATGCTGAAGGGCAGAGG - Intronic
1046406018 8:113773690-113773712 CATTACTTGCTGAAGCTGAAGGG - Intergenic
1046968718 8:120196007-120196029 GGGGAAATGCAGAAGGTGAATGG - Intronic
1047454488 8:124997379-124997401 TGTGACTTGGTGAAGGTCAATGG + Intergenic
1050051085 9:1602275-1602297 AGTGACAAGCTGGAGTTGAAAGG - Intergenic
1050482969 9:6104880-6104902 TGTCACATGATGAAGGAGAAAGG - Intergenic
1051161928 9:14218476-14218498 TGTGAGACGCTGAAGGTGCATGG + Intronic
1051850515 9:21501589-21501611 AGTTACATACTGATGGTGAAAGG + Intergenic
1059112961 9:111574058-111574080 TGTGACTTGCTGTGGGTGAAGGG - Intronic
1059303913 9:113339302-113339324 TGTGACTTGCTGAAGGTCACAGG + Intronic
1059529924 9:115026551-115026573 CGCTACAAGCTGAAGGTGGAGGG - Exonic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1061801853 9:133117066-133117088 AGTGCCATGCTGAAGGTGCCAGG + Intronic
1188484290 X:30666114-30666136 AGTGAAATGCTGCAGGTGTATGG - Intronic
1189809739 X:44770632-44770654 AGTGACATGTTGAAGTAGAATGG + Intergenic
1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG + Intergenic
1191852370 X:65594953-65594975 CATTACATGCTGGAGGTGTAGGG - Intronic
1193904734 X:87227957-87227979 TGTCACATGATGAAGGAGAAAGG - Intergenic
1194613237 X:96070025-96070047 TGTGACTTGCAGAAGGAGAAAGG - Intergenic
1196972378 X:121123831-121123853 CGTGACATTATGAAAGTTAAAGG - Intergenic
1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG + Exonic
1198421309 X:136472771-136472793 CCAGACATCCTGAAGGTGAGTGG - Intergenic
1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG + Intergenic
1200835206 Y:7725829-7725851 CATGCGATGGTGAAGGTGAAAGG - Intergenic
1201147899 Y:11075494-11075516 AGTGACATGCCCAAGGTAAAAGG + Intergenic
1201446311 Y:14059603-14059625 CGTGACATGCAGAGCTTGAACGG - Intergenic