ID: 1087011745

View in Genome Browser
Species Human (GRCh38)
Location 11:93520868-93520890
Sequence ACTTCGTTCTAAGTGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087011743_1087011745 4 Left 1087011743 11:93520841-93520863 CCTTCAGCATGTCACGTATTTTC 0: 1
1: 0
2: 0
3: 8
4: 225
Right 1087011745 11:93520868-93520890 ACTTCGTTCTAAGTGCACAGTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1087011741_1087011745 17 Left 1087011741 11:93520828-93520850 CCAGTGCCTTTCACCTTCAGCAT 0: 1
1: 0
2: 3
3: 20
4: 222
Right 1087011745 11:93520868-93520890 ACTTCGTTCTAAGTGCACAGTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1087011742_1087011745 11 Left 1087011742 11:93520834-93520856 CCTTTCACCTTCAGCATGTCACG 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1087011745 11:93520868-93520890 ACTTCGTTCTAAGTGCACAGTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087011745 Original CRISPR ACTTCGTTCTAAGTGCACAG TGG Intronic
901024938 1:6274166-6274188 GCTTCCTCCTAAGTGCAAAGGGG + Intronic
902535754 1:17118659-17118681 ACTTCATTCTGAGACCACAGAGG - Intronic
902935114 1:19759446-19759468 ACTTTATTCTAAGTGCACTGGGG - Intronic
913550193 1:119910046-119910068 ACTTCCTTCAAAGCACACAGTGG - Intergenic
918884047 1:190167363-190167385 ACTTCATTCTAGGTGGGCAGAGG - Intronic
921499199 1:215880027-215880049 ACTTAGTACCATGTGCACAGAGG + Intronic
923540274 1:234883848-234883870 ACTAGGTTCTGAGAGCACAGTGG + Intergenic
1067142712 10:43669922-43669944 ACTGCCTCCTTAGTGCACAGAGG - Intergenic
1070795462 10:79213711-79213733 ACTTCTTTCTCAGTCCACAAAGG - Intronic
1071116224 10:82223593-82223615 ACTGCATTCTGAGTGCACAAAGG - Intronic
1074764866 10:116693011-116693033 GCTACTTTCTAACTGCACAGTGG - Intronic
1083648348 11:64186039-64186061 ACTTCCTTCTCATTGGACAGCGG - Intronic
1087011745 11:93520868-93520890 ACTTCGTTCTAAGTGCACAGTGG + Intronic
1088981473 11:114868150-114868172 ACATCCTTCTATGTTCACAGTGG + Intergenic
1097897322 12:64838216-64838238 ACTTAGTTCTCAGACCACAGTGG - Intronic
1100282986 12:93136280-93136302 TCTTTGTTGTAAGTGCTCAGAGG - Intergenic
1101833061 12:108274396-108274418 ACTTTGTTCCAGGTGCACAGAGG + Intergenic
1105395899 13:20034239-20034261 ACTTTGTTCTAAATGCACAATGG - Exonic
1109787210 13:67193674-67193696 ACTTCCTTCTAAGGGAAGAGGGG + Intronic
1111002610 13:82205341-82205363 ACCTTGTTCCAAGAGCACAGAGG - Intergenic
1118418738 14:65575526-65575548 GGTTGGTTCTAAGTGAACAGAGG - Intronic
1124971054 15:34490030-34490052 ACTCTGTTCAAAGTGCCCAGCGG - Intergenic
1125532108 15:40420388-40420410 ATTTTGTTATAACTGCACAGTGG + Intronic
1128819559 15:70639585-70639607 ACTTCATTCTAAGTATAAAGTGG - Intergenic
1129929364 15:79397231-79397253 ACTTCGTTCCTGGTTCACAGAGG + Intronic
1131903535 15:97115801-97115823 TCTCCTTTCTAAGTGGACAGTGG + Intergenic
1134825999 16:17284948-17284970 ATCTCATTCTAAGTGCACTGGGG + Intronic
1146016971 17:29241518-29241540 ACTTTGTGGTAAGTGCACAATGG - Intergenic
1153546683 18:6213715-6213737 ACTTAGTTTTAAGAGCACATAGG + Intronic
1153845818 18:9048999-9049021 ACACCTTTCTAAGTGCACTGGGG - Intergenic
1156756647 18:40535863-40535885 ACTGCGTTTTAAGTTCCCAGAGG - Intergenic
1165072028 19:33261245-33261267 ACTTCACTCTGAGTGCAGAGAGG - Intergenic
1165849966 19:38844077-38844099 ACTCAGTTCAAAGTGCCCAGCGG - Exonic
1166665990 19:44680731-44680753 ACTTTGTCCCAAGGGCACAGGGG - Intronic
927118638 2:19930436-19930458 ACTTCTTTATACTTGCACAGAGG - Exonic
929856325 2:45641280-45641302 ACTTCCTACTAAATACACAGAGG - Intergenic
930409821 2:51011348-51011370 ACTTGATTCTAAGTCCCCAGGGG - Intronic
933505030 2:83165980-83166002 ACTTCATTCGCAGGGCACAGGGG - Intergenic
939136034 2:138295115-138295137 ACTTCATTGTGAGTTCACAGGGG - Intergenic
941410575 2:165151898-165151920 ACTTCGTTTTAAATGCGCATTGG + Intronic
941691815 2:168508097-168508119 ACTGCGTTCTAATTATACAGTGG + Intronic
944988168 2:205203204-205203226 ACAATGTTCTAAGTACACAGAGG - Intronic
945572124 2:211481165-211481187 GCTTTGTTCTAAGTTCAAAGTGG - Intronic
1174822607 20:53740209-53740231 ACTTTGTTCTAAATCCCCAGTGG - Intergenic
1175355893 20:58367772-58367794 ACTTCCCTCTAAGTGCTCACTGG - Intergenic
1177235963 21:18390623-18390645 ACATGGTGCTAAATGCACAGGGG + Intronic
953986998 3:47451794-47451816 GCTTTGTTCTAAGTGCAGAAGGG - Intronic
961424728 3:126836122-126836144 ACTGCCTTCTATGAGCACAGGGG - Intronic
963040815 3:141068542-141068564 ACTTATTTCCAAGTGCTCAGTGG + Intronic
964170289 3:153762065-153762087 AATTAATTCTAAGTGCACAAGGG - Intergenic
967431372 3:189389884-189389906 ACTTCCTTCTAGGTAGACAGTGG - Intergenic
972358343 4:38303503-38303525 ACTTTGTTCCAAGATCACAGTGG + Intergenic
977357118 4:95960524-95960546 ACTTCTTTCTAAGTTCTCAGAGG + Intergenic
977773906 4:100894565-100894587 AATTGGTACTAAGTGCAGAGAGG - Intergenic
981185063 4:141791688-141791710 ACATAGTTCTAAGTGAAAAGAGG + Intergenic
986559426 5:9046083-9046105 ACTTGGTTCTAACAACACAGAGG - Intronic
988995641 5:36712470-36712492 ACTTCATTCCAAGTGACCAGTGG + Intergenic
993673160 5:90786412-90786434 ATTTCATTCTAAGTGCAAATAGG + Intronic
995580704 5:113598885-113598907 ATTTTCTTATAAGTGCACAGTGG - Intergenic
1000252574 5:159509750-159509772 AACTCCTTCTAAGAGCACAGAGG + Intergenic
1000650629 5:163814235-163814257 CCTTGGTTATATGTGCACAGAGG + Intergenic
1002949371 6:1793989-1794011 ACTTCATTTTAAGTGAACAGGGG + Intronic
1003596950 6:7482126-7482148 ACTGTGTTCAAAGTGCCCAGTGG - Intergenic
1013442318 6:110182865-110182887 AGATCATTCTAAGTGCACTGTGG - Intronic
1018379837 6:163248747-163248769 GCTTCGTCTTAAGTGGACAGAGG - Intronic
1020637660 7:10715851-10715873 TCTTTGTAATAAGTGCACAGGGG + Intergenic
1020989674 7:15181259-15181281 ACTTCATGCTAAGTGTAGAGAGG + Intergenic
1021447136 7:20745862-20745884 GCTTTATTCTAAGCGCACAGGGG - Intronic
1021646057 7:22790698-22790720 ACTTCCTTTTAAGTAAACAGAGG - Intergenic
1023640599 7:42253275-42253297 ACCTTGTTCACAGTGCACAGTGG + Intergenic
1025224720 7:57147959-57147981 ACTTAGTTTTTATTGCACAGAGG - Intergenic
1027593411 7:80142055-80142077 ACTTCGTTCTGAGCCCACACTGG + Intronic
1038431893 8:27507134-27507156 ACATCGTGCTGACTGCACAGTGG - Intronic
1039760199 8:40566327-40566349 TCTTCATTCTATGTGCACATTGG - Intronic
1045707639 8:104944780-104944802 ACTTGATTCTAAGTGTGCAGGGG - Intronic
1049054398 8:140224080-140224102 ATTTTCTTCTAAGTGCAGAGAGG - Intronic
1058910546 9:109516623-109516645 ACTTGGTTCCAAGGGCACTGGGG + Intergenic
1058981633 9:110175838-110175860 TCTTTGTTCTAAGTTCAAAGTGG + Intergenic
1059885780 9:118743287-118743309 ACTTAGTGCCAAGTACACAGTGG - Intergenic
1187260011 X:17676813-17676835 ACTGCTATCTAAGAGCACAGTGG + Intronic
1192168785 X:68841795-68841817 ACTGGGGTCAAAGTGCACAGCGG - Exonic