ID: 1087012885

View in Genome Browser
Species Human (GRCh38)
Location 11:93530075-93530097
Sequence TTTTATACACAGAAGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087012883_1087012885 23 Left 1087012883 11:93530029-93530051 CCTGCTGACCAGGAGAGCTGACT 0: 1
1: 0
2: 2
3: 16
4: 206
Right 1087012885 11:93530075-93530097 TTTTATACACAGAAGAATCCTGG 0: 1
1: 0
2: 1
3: 23
4: 317
1087012884_1087012885 15 Left 1087012884 11:93530037-93530059 CCAGGAGAGCTGACTCAACTCTT 0: 1
1: 0
2: 1
3: 24
4: 186
Right 1087012885 11:93530075-93530097 TTTTATACACAGAAGAATCCTGG 0: 1
1: 0
2: 1
3: 23
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087012885 Original CRISPR TTTTATACACAGAAGAATCC TGG Intronic
900754446 1:4424055-4424077 TCTTATACAAAGAGGAAACCTGG + Intergenic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
902073251 1:13760666-13760688 TTTTATAGACAGAAAAATTAAGG - Intronic
902781234 1:18706201-18706223 CCTTATACACAGAGGATTCCTGG - Intronic
903031642 1:20467917-20467939 TTTTAGACACAGAAGCATCAAGG + Intergenic
903137175 1:21317297-21317319 TTTAATTCTCAGAAGAGTCCCGG - Intronic
907234112 1:53029232-53029254 TTTTAAACTTAGAAGAATCTTGG + Intronic
907574152 1:55510800-55510822 TTTTAGACAAGGAAGAAGCCAGG + Intergenic
911057541 1:93721370-93721392 TTGTCAACCCAGAAGAATCCTGG + Intronic
911616425 1:100016671-100016693 TCTTAAAAACAGAAGTATCCGGG - Intronic
912027264 1:105192753-105192775 TTTTATAAGCAGAACAAGCCAGG - Intergenic
915455243 1:156036173-156036195 TCTTTTAGGCAGAAGAATCCAGG - Exonic
917628700 1:176872152-176872174 TTTTATTCTCACAAGAATCTTGG - Intronic
918898217 1:190376520-190376542 TTTTATTCTCATAAAAATCCAGG + Intronic
919208838 1:194453763-194453785 CTTCATAGACAGAAGAGTCCAGG - Intergenic
919647407 1:200108834-200108856 TTGCATACACAGCAGATTCCAGG - Intronic
922129867 1:222766951-222766973 TTTTATAGACACAAATATCCAGG - Intergenic
922131887 1:222788062-222788084 TTTTCCAAACAGATGAATCCTGG + Intergenic
922700420 1:227756495-227756517 TTTGATACACAGAATATTTCTGG + Intronic
923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG + Intergenic
924819892 1:247479062-247479084 TTTTATACATAGAGGAGTCTGGG + Intergenic
924941661 1:248816463-248816485 ATATAGAGACAGAAGAATCCAGG + Intronic
1062960000 10:1565779-1565801 TTTTATCCGAAGAAGATTCCTGG + Intronic
1063285186 10:4679233-4679255 TTTCATACCCAGTAGAATCTGGG - Intergenic
1063594708 10:7423795-7423817 TTTTAGTGACATAAGAATCCGGG + Intergenic
1065516004 10:26524971-26524993 TTTTATAAAAAAAGGAATCCTGG + Intronic
1067322829 10:45238484-45238506 TTTTATATACATAAGAATGAAGG + Intergenic
1068613186 10:59083252-59083274 TTTTATCTATAGAAGAATCATGG + Intergenic
1070041355 10:72783573-72783595 TTTTTTCCTCAGAAGAAACCAGG - Intronic
1072837970 10:98737223-98737245 TTATATACACATAAAAATACAGG + Intronic
1073052784 10:100679712-100679734 TTTTAAACTCAGAACAATGCTGG - Intergenic
1074931380 10:118129851-118129873 ATTTAAAGACAGAAGACTCCAGG - Intergenic
1076013468 10:127008962-127008984 TTTTGTAGCCATAAGAATCCTGG + Intronic
1077726119 11:4676533-4676555 ATTTATAAACATAAGAATTCTGG - Intergenic
1079786583 11:24680768-24680790 TTTTATACATATAGGAATCAAGG + Intronic
1081301881 11:41462673-41462695 TTTGATACACAGAGGGGTCCTGG + Intergenic
1081509487 11:43755017-43755039 CATTATACACAGAAGCTTCCTGG - Intronic
1081777027 11:45682624-45682646 TTTGATCCTCAAAAGAATCCTGG - Intergenic
1082730287 11:56788185-56788207 TTTCATACAGAGACAAATCCTGG - Intergenic
1083016107 11:59455895-59455917 TTATATACACACTAGAATTCCGG + Intergenic
1083174400 11:60940320-60940342 TTTTATCCTCACAATAATCCTGG - Intronic
1085890848 11:80577310-80577332 TTATTTACACAGAAAAACCCCGG + Intergenic
1086997173 11:93371604-93371626 TCTTTGACTCAGAAGAATCCTGG + Intronic
1087012885 11:93530075-93530097 TTTTATACACAGAAGAATCCTGG + Intronic
1087559640 11:99771206-99771228 GTATATACACAGAAGATTGCTGG - Intronic
1088983085 11:114881453-114881475 TTTTAGAGACAGAAGAAGCCAGG - Intergenic
1090266626 11:125357281-125357303 TTTTACACAATGAAGAGTCCAGG - Intronic
1090540995 11:127704561-127704583 TTTTCTACACAGAAAACTCCAGG - Intergenic
1091487195 12:900784-900806 TGTTGTACACTGAAGAATCTGGG + Intronic
1092918070 12:13206238-13206260 TTTTCTCCCCAGAAAAATCCTGG + Intronic
1093651170 12:21647508-21647530 TTTTATGGACAGAGGAATCTAGG + Intronic
1095387177 12:41664692-41664714 TTTTTTGTACAGAAGAATCTAGG + Intergenic
1095414617 12:41962610-41962632 TTTCATGCTCAGAAGTATCCTGG - Intergenic
1096355802 12:50939696-50939718 TTTCATCCTCATAAGAATCCTGG - Intergenic
1097309472 12:58102599-58102621 TTTGGATCACAGAAGAATCCTGG - Intergenic
1097534846 12:60855489-60855511 TTATATACATAGAATATTCCAGG + Intergenic
1097910052 12:64959781-64959803 TTTAATAAACAGAAGAGGCCGGG + Intergenic
1097937887 12:65274152-65274174 TTTTATAGACACAAGTATCAAGG + Intergenic
1098310433 12:69143410-69143432 TTTTATATACGAAAGAATCTTGG + Intergenic
1100159097 12:91836802-91836824 TTCTATAAACAGGAGATTCCAGG - Intergenic
1100424443 12:94470554-94470576 TTTGATAAACAGAAGAAGCCAGG + Intergenic
1100516835 12:95336217-95336239 TTTTATACACATGTGCATCCAGG - Intergenic
1101993739 12:109509671-109509693 TCTTAAACACAAAAGAATTCAGG - Exonic
1104094340 12:125543088-125543110 TTTTAGAAACAGCTGAATCCAGG + Intronic
1104288742 12:127448965-127448987 TTTAAAACACAGAAAAACCCTGG + Intergenic
1105312904 13:19229182-19229204 CTTTAAACAGAGAAAAATCCAGG - Intergenic
1106430721 13:29677870-29677892 TTTTATAGACAGAAGAAATGAGG - Intergenic
1107939762 13:45373212-45373234 TTATGTACACAGAAGAATGAAGG - Intergenic
1108124577 13:47227694-47227716 TTTTTTATATAGAAGAATCAAGG + Intergenic
1108770609 13:53695966-53695988 TTTTATAAACTGAAGATTTCTGG + Intergenic
1109345651 13:61112747-61112769 TTTTATACAAAAAAGAATTTAGG - Intergenic
1109447981 13:62470325-62470347 TTTTATACTAGGAAGAATCTGGG + Intergenic
1109755586 13:66755251-66755273 TTTTCTACAGAGAAGGATACTGG + Intronic
1109917343 13:69007683-69007705 TATCATACAAAGAAGAATGCAGG + Intergenic
1110015569 13:70396914-70396936 TTATTTACAGAGAAGAATCCAGG - Intergenic
1110474099 13:75892970-75892992 TTTTATAGACACAAGAGTCTAGG + Intergenic
1111391885 13:87607033-87607055 TTCTATACACAGAATAAGCAAGG + Intergenic
1112679611 13:101748160-101748182 TGTTATACACATAAAAGTCCAGG - Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113105686 13:106769587-106769609 TTTTATAGACAAAAAAATCGAGG - Intergenic
1113959497 13:114118822-114118844 TTTTATGAACACAAGAATGCTGG - Intronic
1114340609 14:21738990-21739012 TTTTAACCACAGAAGAACCCTGG - Intergenic
1115070520 14:29317028-29317050 ATTTAAACAAAGAAGAATCTAGG + Intergenic
1115693293 14:35869190-35869212 TAACATAAACAGAAGAATCCAGG - Intronic
1116349761 14:43845986-43846008 TTTTCAACACAGACGATTCCAGG - Intergenic
1117779667 14:59219430-59219452 TGCTATACCCAGAAGAAACCAGG - Intronic
1118171433 14:63393326-63393348 TTCTATGCACAGTAGAATCATGG - Intronic
1119559696 14:75580116-75580138 TTTTACACACAGCTGAAGCCAGG + Intronic
1120612796 14:86663658-86663680 TTTTAGACTCAGAAGACTCTAGG + Intergenic
1121185984 14:91969877-91969899 CTTTAGATACAGCAGAATCCAGG - Exonic
1124509349 15:30309833-30309855 ATTTATACAGACAAAAATCCAGG + Intergenic
1124734211 15:32228829-32228851 ATTTATACAGACAAAAATCCAGG - Intergenic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1124964235 15:34421381-34421403 TTTTATACAGAGCAGAGTGCTGG - Intronic
1124980849 15:34567609-34567631 TTTTATACAGAGCAGAGTGCTGG - Intronic
1125355242 15:38810802-38810824 TGTCAAACACAGAAGAATTCTGG - Intergenic
1125576017 15:40755971-40755993 TTGTATACATATAAGAATACAGG + Intergenic
1125917307 15:43500499-43500521 TTTTAGACACAGAAGTATTTTGG - Intronic
1126484600 15:49166415-49166437 TTTTATGAACAGAAGAATAAGGG + Intronic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1134455053 16:14389271-14389293 TTTTATACAGACAAAAATCTTGG - Intergenic
1136519842 16:30788139-30788161 TTACAAACACAGAGGAATCCTGG + Intergenic
1137067806 16:35867501-35867523 TTTGATACACAGAAGCAACTTGG + Intergenic
1137763303 16:50958071-50958093 TTTTATACACAGTACATCCCGGG + Intergenic
1138130697 16:54477248-54477270 TTATACACACTGAAGACTCCTGG - Intergenic
1138253892 16:55534676-55534698 TTTTGCACACAGAAGACTCCAGG - Intronic
1138881884 16:61026519-61026541 TTTTAAACATAGTTGAATCCAGG - Intergenic
1138944687 16:61834436-61834458 TTTTATAGACTGAAGAACACGGG + Intronic
1140862690 16:79032744-79032766 TTTTAAAAAAAGAAGAACCCTGG - Intronic
1141966069 16:87444504-87444526 ATTTTTACACAGGAGAATCCTGG + Intronic
1142636494 17:1260684-1260706 ATATATACACACAAGATTCCTGG - Intergenic
1143060279 17:4194828-4194850 TTTTATATACAGTAAAAGCCTGG - Intronic
1143643155 17:8211093-8211115 TTTTATAAAAAGAAGAAGGCCGG - Intergenic
1147378903 17:40040508-40040530 TTTTAAAAATAGAAGAATCTAGG - Intronic
1150965385 17:69961933-69961955 TTTTGTACTCTGAAGATTCCCGG - Intergenic
1150967208 17:69984900-69984922 TTGTATACATAGAAAATTCCAGG + Intergenic
1152511167 17:80790017-80790039 TTTTATCCACAGAGAAATTCTGG + Intronic
1152592115 17:81218814-81218836 TTTTATTCACAGTGGAACCCTGG + Intronic
1153338304 18:3947821-3947843 TTATATTAATAGAAGAATCCAGG + Intronic
1156058906 18:33048584-33048606 TTTTAGACACAAAAGATTTCTGG + Intronic
1156178265 18:34573184-34573206 TTTTAAACACAGAGGAATAAAGG - Intronic
1156681053 18:39589179-39589201 TTTTATACTCAGAAAATTCCAGG - Intergenic
1157549921 18:48574360-48574382 TTTTATGCACAGGATAATGCAGG - Intronic
1158056776 18:53290729-53290751 TTTTATATACAGAAAAATTTAGG - Intronic
1160055488 18:75475570-75475592 CTCTATAAACAGATGAATCCTGG - Intergenic
1162182708 19:8881457-8881479 TATTATAGGCAGAAGAATCATGG - Intronic
1162684865 19:12373779-12373801 TTATATACAAAGAACTATCCTGG - Intergenic
1163086675 19:14986132-14986154 TTCTACACACAGAAGTATCATGG - Intronic
1164961690 19:32436758-32436780 TTTTGTACACAGATGCTTCCTGG + Intronic
1165377553 19:35453514-35453536 TTTAATCCACAGAATAATCTTGG - Intergenic
1166738296 19:45098972-45098994 TTTTAGACACAGAAAAATCGAGG - Intronic
926183071 2:10663648-10663670 TTTAATGAAAAGAAGAATCCCGG + Intronic
926510574 2:13772456-13772478 TTTTTTACATATAAGAATCTTGG + Intergenic
928228018 2:29471155-29471177 TTTTCTACAGAGAATATTCCAGG + Intronic
929387805 2:41431817-41431839 ATTTATATACAGAAAACTCCTGG - Intergenic
929414731 2:41735929-41735951 GCTTCTAAACAGAAGAATCCTGG - Intergenic
929725369 2:44420609-44420631 TTTTATACACAGTTGACTCCTGG - Intronic
929761120 2:44807298-44807320 TTTCATACACACCAGATTCCAGG + Intergenic
929820699 2:45271287-45271309 TTTTATACAAAGCACAATCAAGG + Intergenic
930507321 2:52300116-52300138 TTTTGTACACAGTAGATTACAGG + Intergenic
930984364 2:57567118-57567140 TTTTATCAATGGAAGAATCCAGG - Intergenic
931164763 2:59734469-59734491 TTTTATACAGATATGAATCATGG - Intergenic
931638371 2:64360592-64360614 GTTTACACACAGAAAAATCTGGG - Intergenic
931704300 2:64934450-64934472 ATTTTTACACAGAAGAATCTAGG - Intergenic
933501133 2:83112928-83112950 TTTAAACCACAGAAGAATTCAGG + Intergenic
937211687 2:120276825-120276847 TTTTATGCACATAAGAAAACTGG + Intronic
937327087 2:120996482-120996504 TTCTAAACCCAGAAGAAGCCAGG + Intergenic
937718758 2:125065474-125065496 TTTGATACACAGAATATTCCTGG - Intergenic
938234940 2:129698547-129698569 TTTTAGAAACAGCAGACTCCAGG + Intergenic
940726320 2:157340785-157340807 TGTTAAACACAGAAGAATTGAGG + Intergenic
941223722 2:162818277-162818299 TTTTGTACACAGTATAATGCAGG + Intronic
941557074 2:166994669-166994691 TTTGATAGACTGAGGAATCCAGG - Intronic
941576096 2:167232181-167232203 TTTTAGGCAAAGAAGAATCGTGG + Intronic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942842886 2:180384323-180384345 TTTAAGACACAGAAGAAATCAGG + Intergenic
943079729 2:183244113-183244135 ATTTATACATAGATGAATGCTGG - Intergenic
943785014 2:191867807-191867829 CATTATACACTTAAGAATCCAGG + Intergenic
943978892 2:194520988-194521010 TTATAGACACAGAACTATCCTGG - Intergenic
944176466 2:196833788-196833810 TTTTATTCACAGGATAATCATGG - Exonic
944430644 2:199629959-199629981 TTTTATTCACAGAAGAAAAAAGG + Intergenic
946466610 2:219917751-219917773 TTTTTTTCACAGATGCATCCTGG + Intergenic
946482795 2:220073217-220073239 TTTAATCCTCAGAAGAATCAAGG + Intergenic
946747824 2:222862691-222862713 TTTTATACAAAAGAGAAACCAGG - Intronic
946852138 2:223918000-223918022 TTTTCTCCACAGAACCATCCGGG - Exonic
948457485 2:238113409-238113431 TTTTAAATAAAGAAAAATCCAGG - Intronic
1169012109 20:2259441-2259463 TGTTATAAACAGAAAAATGCTGG - Intergenic
1169186408 20:3620804-3620826 CTTCATAGACAGAAGAATGCAGG + Intronic
1169957326 20:11118963-11118985 TGTGATTCACAGAAGATTCCAGG - Intergenic
1170275362 20:14580587-14580609 TTGTTTACACAGCACAATCCTGG - Intronic
1170519831 20:17173170-17173192 TTTTCTACCCAGAAGATTCTGGG + Intergenic
1171052596 20:21873917-21873939 TCTGATTCCCAGAAGAATCCTGG - Intergenic
1173122543 20:40307093-40307115 TTTAAAACACTGCAGAATCCAGG - Intergenic
1173383666 20:42568737-42568759 TCTTATTCCCAGATGAATCCAGG - Intronic
1173804646 20:45916266-45916288 TTGTGTACCCAGATGAATCCAGG + Intergenic
1174921031 20:54702238-54702260 TTTTAAAAAGAGGAGAATCCAGG - Intergenic
1175789428 20:61732155-61732177 TTTTGTACACAGAAAAATCTTGG - Intronic
1177410598 21:20725654-20725676 TTTTATCCACATAAGGATCTTGG + Intergenic
1179110825 21:38443577-38443599 TCTGAAACACAGAAGAATGCAGG - Intronic
1179121597 21:38550939-38550961 CTTTGTACACAAAAGAATTCAGG + Intronic
1179458506 21:41516422-41516444 ATTTATACAAACAGGAATCCAGG - Intronic
1179562537 21:42224731-42224753 TTCAAAACACAGAAGAACCCTGG - Intronic
1182855638 22:33515650-33515672 TTTTATACACTGAAGAACCCAGG + Intronic
1183187792 22:36302249-36302271 TATTATACACAAAAGCAGCCCGG + Intronic
1183852479 22:40602438-40602460 TATTACAAACAGAAGAATCGTGG + Intronic
949253498 3:2017001-2017023 TTTTAATCACAGCAGAATACTGG - Intergenic
949317455 3:2772582-2772604 TTTCACACTCATAAGAATCCAGG - Intronic
950225504 3:11230303-11230325 GCTCATACACAGAAGAATCAAGG + Intronic
950267752 3:11587829-11587851 TTTCATCCACACAAGAAACCTGG + Intronic
950624461 3:14234625-14234647 TTTTATTCAGAGAGGATTCCTGG + Intergenic
950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG + Intergenic
951106278 3:18746931-18746953 TTTGCTACTCAGAAGATTCCTGG + Intergenic
951316741 3:21196369-21196391 TTTAATCCTCACAAGAATCCTGG - Intergenic
951641964 3:24846272-24846294 TTTAATCCACACAATAATCCAGG - Intergenic
953007671 3:38993271-38993293 TTTTATTCATTGGAGAATCCAGG + Intergenic
953761822 3:45694425-45694447 TATTATTCACAGAAGTCTCCCGG + Intronic
956490697 3:69768487-69768509 TATTTTACATGGAAGAATCCGGG + Intronic
956546128 3:70405314-70405336 TTTTAAAGAAAGAAAAATCCTGG + Intergenic
957593397 3:82228391-82228413 TTTTATACACAGTAAAATTATGG + Intergenic
957598269 3:82296787-82296809 TTTTATAAAAAGAAGTCTCCAGG - Intergenic
957762567 3:84577642-84577664 TTCTAAACAAAGAAGAATCCAGG + Intergenic
958581378 3:96029683-96029705 TTTTAAAAACAGAAGATTGCTGG - Intergenic
958839214 3:99183191-99183213 TTTTATACACAAATGCATCTAGG - Intergenic
959397622 3:105860817-105860839 TTTTCTGCACAGAACATTCCAGG - Intronic
959712628 3:109400217-109400239 TTTTAAACACAAAAGAACTCAGG + Intergenic
961103332 3:124220628-124220650 TTTTCTACACAGAAGAGACCAGG + Intronic
961239837 3:125401011-125401033 ATTCAGACACAGAAGAACCCAGG - Intergenic
961945007 3:130677262-130677284 TTTTAAACCAAGAAGCATCCTGG - Exonic
962554792 3:136537283-136537305 TTTAATATACAGAATAAGCCTGG + Intronic
963732149 3:148985056-148985078 TCTTTTAGGCAGAAGAATCCAGG - Intergenic
963792494 3:149598337-149598359 TTTAATACTCACAATAATCCTGG + Intronic
965366349 3:167805109-167805131 TTTTTTAAACAAAAGAATCATGG - Intronic
965972891 3:174584758-174584780 ATTTATACACAACAGAATCCAGG - Intronic
966087596 3:176087820-176087842 TTTTATAAACAGAAGGTTTCTGG - Intergenic
967159214 3:186720375-186720397 TTGTATAGACAGAAAAATCATGG + Intronic
967433021 3:189410624-189410646 TATTATACATAGAAAAATCATGG - Intergenic
968147659 3:196312796-196312818 TCTCAAACACAAAAGAATCCAGG + Intronic
970279375 4:14437123-14437145 TTTTCTAGACAGAAGAACCCAGG + Intergenic
970638802 4:18040435-18040457 TTTTATAAACAAAATTATCCAGG + Intergenic
971466251 4:26965255-26965277 TTCTCTTCACAGAAGAAACCCGG - Intronic
971508359 4:27391732-27391754 TTATATACACAAAGGAATCCAGG - Intergenic
971770036 4:30884255-30884277 TTTTATAAACAGAAAAAAGCAGG + Intronic
974511860 4:62853660-62853682 TTTAATTCACAGAGGAATTCTGG + Intergenic
975200312 4:71580558-71580580 TTTTATACACAGATTTATACTGG - Intergenic
975330228 4:73104589-73104611 CTGTATAGACAGAAAAATCCTGG + Intronic
975975010 4:80085140-80085162 TTTGATACATTGAAGAATACAGG - Intronic
976136932 4:81947699-81947721 TTTTAAAGAGAGAAGAATCATGG - Intronic
977309451 4:95367197-95367219 TTTTTTTCAAAGAAAAATCCAGG + Intronic
977421274 4:96802968-96802990 TTTTATACACAGAAAAAGTGAGG + Intergenic
978270045 4:106877994-106878016 TTTTCTACTCTGAAGAATCAAGG - Intergenic
979834001 4:125338843-125338865 TTTTAAAAACAGAAGAATAAAGG - Intronic
980074256 4:128277408-128277430 TTTAATAAACAGAAAATTCCAGG + Intronic
980237261 4:130124537-130124559 TTTTATTCTCAGAAGTATCCTGG - Intergenic
981245570 4:142533437-142533459 TTTTATACATTTTAGAATCCAGG - Intronic
981296250 4:143135321-143135343 TTTTAAACTAAGAAGAATCAAGG - Intergenic
982639975 4:157946130-157946152 TGCTATACACAGAAGATTCTAGG - Intergenic
985258296 4:188091357-188091379 TTTTACACACAGAAGATTAAGGG + Exonic
985657919 5:1141656-1141678 TTTTAAAAAATGAAGAATCCAGG + Intergenic
987506385 5:18778807-18778829 TTTTTTAAACAGAAAAATGCTGG - Intergenic
991233969 5:64372284-64372306 TTTTATACTCAGCAGAAGACAGG + Exonic
991430572 5:66540636-66540658 TTAAATACAGAGAAAAATCCAGG - Intergenic
992408543 5:76482649-76482671 TTTTATCCACAGGAAAATCAAGG + Intronic
993005697 5:82425979-82426001 ATTTATACACAGAAGGATTAAGG - Intergenic
993201138 5:84816703-84816725 TTGTTTACAAAGCAGAATCCTGG + Intergenic
993488072 5:88511629-88511651 TTTTATAGAAAAAAGAATCTTGG + Intergenic
993754879 5:91716288-91716310 TTTTAACCACAAAAGAATACTGG + Intergenic
995599853 5:113783504-113783526 TTTTATTCAGAAAAGAATTCAGG + Intergenic
995680753 5:114716748-114716770 TTTTAAACACAGAAGAGCTCAGG - Intergenic
997877470 5:137562215-137562237 TTTTATATACACATGAATGCTGG + Intronic
999051619 5:148529816-148529838 TGATATACACAGTAAAATCCAGG + Intronic
999463858 5:151782198-151782220 TTTTACAGACAGAAGAATTGAGG + Intronic
999674985 5:153990183-153990205 TTTTCTAAACTGAAGAATTCAGG + Exonic
1000066985 5:157702388-157702410 TTTTCTACAAAGAAAAATCTAGG - Intergenic
1002512980 5:179734980-179735002 TTTTATTCTTAAAAGAATCCTGG - Intronic
1003308893 6:4951845-4951867 TTTAATACACAAAACAATCCTGG - Intronic
1003355137 6:5361882-5361904 TTCTTTACACAGAAGAATGAGGG + Intronic
1005560275 6:27033293-27033315 TTTTATTTTAAGAAGAATCCTGG - Intergenic
1008154332 6:47995285-47995307 TTACATACACAGAAGTTTCCAGG + Intronic
1008345142 6:50417379-50417401 AAATATAAACAGAAGAATCCAGG + Intergenic
1009324646 6:62336066-62336088 TTTGTTAGACAGAAGAATGCAGG + Intergenic
1009930615 6:70173351-70173373 TTTTAGAAACAGAAGAGTCAAGG + Intronic
1009995912 6:70894885-70894907 TGTTACACACAGTGGAATCCTGG + Intronic
1010169626 6:72959780-72959802 TTTTATAAACTTGAGAATCCGGG + Intronic
1011682992 6:89801002-89801024 TGCAATACACAGAAGTATCCTGG - Intronic
1012537292 6:100314328-100314350 TATTACACACCAAAGAATCCTGG + Intergenic
1015748893 6:136540238-136540260 ATTTATAGACAGAAGAAACAAGG + Intronic
1015832163 6:137382580-137382602 TTTTATAGACAGATAGATCCTGG - Intergenic
1016275072 6:142340095-142340117 TTATATGCACAGTAGAAACCAGG + Intronic
1016389793 6:143563272-143563294 TTTTATCAAGAGAAGAAACCCGG + Intronic
1016495013 6:144651392-144651414 TATTCTACACAGAAAAATCAAGG + Intronic
1017702623 6:157090291-157090313 TTTTATAAACAAAAGTAGCCAGG - Intronic
1017891235 6:158641043-158641065 TTTTAAGCATAAAAGAATCCTGG - Intronic
1017950928 6:159134386-159134408 TTTTCTATAGAGACGAATCCTGG + Intergenic
1019362228 7:610758-610780 TTTTACAGACAGAAGAGGCCAGG - Intronic
1019704479 7:2490986-2491008 ATTTATACTCAGATGAACCCTGG - Intergenic
1020463628 7:8451722-8451744 TCTTATATTCAGAAGTATCCTGG + Intronic
1020883257 7:13790941-13790963 TTTTATCCAGAGCAGAAACCAGG + Intergenic
1020980936 7:15068095-15068117 TTTTATAAATTGTAGAATCCTGG - Intergenic
1021019835 7:15583649-15583671 TGTTACACACGGAAGTATCCTGG + Intergenic
1021783047 7:24124912-24124934 TTTTATTCACAAAGGAATCAGGG + Intergenic
1022231827 7:28421569-28421591 TTTGACACATAGGAGAATCCAGG + Intronic
1023576043 7:41628014-41628036 CTGTATCCACAGAAGAATGCAGG + Intergenic
1023679470 7:42670416-42670438 TATTATATACAGAAGAAGCATGG + Intergenic
1023681004 7:42687091-42687113 TTATATACACTGAAGAACCTAGG + Intergenic
1023726919 7:43152096-43152118 TTGTCTACACAAAGGAATCCAGG - Intronic
1027636152 7:80677374-80677396 TTTTACCCACAGAAGGATACAGG + Intronic
1027720738 7:81738445-81738467 TTTTATACACAGAATATTTGTGG + Intronic
1028297961 7:89159131-89159153 TTTTGTACAAAGAATCATCCAGG - Intronic
1030449831 7:109694072-109694094 TTTTATACACAGAAAAAAAGTGG + Intergenic
1031209121 7:118799962-118799984 TTTAATATACAGAAATATCCAGG - Intergenic
1031890036 7:127283279-127283301 TTTTAAACACAGAGGGATTCTGG + Intergenic
1031960634 7:127986440-127986462 TTTTATAGACAGATGAGGCCTGG + Intronic
1032083522 7:128871763-128871785 TTTTAAACAAAGGAGACTCCTGG + Intronic
1032576108 7:133056712-133056734 TCTTTAACACAGAAGCATCCAGG - Intronic
1032867473 7:135941221-135941243 TTTGATTCTCAGAATAATCCTGG + Intronic
1032880177 7:136081388-136081410 TTTTATACACCGAACTCTCCTGG + Intergenic
1033881548 7:145890200-145890222 TTGCAGACACAGAAGAAACCTGG - Intergenic
1036183255 8:6602613-6602635 TTTAATACACAGCAAATTCCTGG + Intronic
1036752902 8:11454583-11454605 TTTCATACACAGAAAATTCAGGG + Intronic
1038613378 8:29072725-29072747 TTTCATACAAAATAGAATCCAGG + Intronic
1038646031 8:29363143-29363165 TTTTTTACAAAAATGAATCCAGG - Intergenic
1039141213 8:34390653-34390675 TTTTAGACTAAGAATAATCCAGG - Intergenic
1041709717 8:60883081-60883103 TTTTCTCCACAGATGAATTCAGG + Intergenic
1041729425 8:61049914-61049936 TTTTGTTCACAGAATAATACAGG - Intergenic
1042424164 8:68626962-68626984 TTTTATCCAGAGAAGTGTCCTGG + Intronic
1042515657 8:69656046-69656068 TTTGAAACACACAAGAATGCAGG - Intronic
1044375895 8:91470222-91470244 TTTTATAGACAGGAGAATTGAGG + Intergenic
1044947602 8:97404988-97405010 TTACACACACAGAATAATCCAGG - Intergenic
1046035669 8:108837893-108837915 TTTTATCAAAAGAAGAAACCAGG - Intergenic
1046227222 8:111298509-111298531 TTTTATATACTGTAGAATTCGGG + Intergenic
1048090001 8:131229542-131229564 TTTTATAGACAGGAAAATCACGG + Intergenic
1048418636 8:134254609-134254631 TTTTATAGACTGAGCAATCCAGG - Intergenic
1049137862 8:140921328-140921350 TTTTGTAAACAGAAGACTGCTGG - Intronic
1050052215 9:1614988-1615010 TTTTTTACACAGAAGACTAAAGG - Intergenic
1050396367 9:5201868-5201890 TTTTATACACAAATGACACCAGG + Intergenic
1051566064 9:18499512-18499534 ATCTATACACAGAAACATCCTGG - Intronic
1052404426 9:28041394-28041416 TTTTATACACAGAAGCACACAGG - Intronic
1053132860 9:35628128-35628150 TTTTTTAAAAAGAAGAAGCCAGG - Intronic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1055382662 9:75725841-75725863 TTTTATAGACAGATGAATTTAGG - Intergenic
1055408954 9:76006780-76006802 TTTTATACAATTAAGAACCCAGG - Intronic
1055832607 9:80400110-80400132 TTTTATACCCAGATAAAACCTGG + Intergenic
1058231046 9:102425999-102426021 TTCTATACCCAGAAGTATCCAGG + Intergenic
1059592505 9:115677383-115677405 ATTTATACAGACAAAAATCCAGG + Intergenic
1186042209 X:5492916-5492938 TTTTGTACACAGACCAATACTGG - Intergenic
1186610450 X:11133536-11133558 TATAATCCTCAGAAGAATCCTGG + Intergenic
1187597401 X:20788243-20788265 ATTTAGACAGAGAAGAATCAAGG - Intergenic
1188842156 X:35029510-35029532 TTTTAAACACAGAAAACTCAGGG - Intergenic
1189781112 X:44515295-44515317 TTTAAGACACAGAAGAACTCAGG + Intergenic
1193747683 X:85301708-85301730 TATTTTACACAGAAGAAGGCAGG + Intronic
1194006523 X:88500762-88500784 TTTTATACTCATAAAAATCATGG - Intergenic
1194128221 X:90046268-90046290 TTTGAAAAACAGAGGAATCCGGG - Intergenic
1194385377 X:93245943-93245965 CTTGATACAAAGAAGATTCCAGG - Intergenic
1195426465 X:104738206-104738228 TTTTACACTCAAAAGTATCCTGG - Intronic
1196815140 X:119659519-119659541 TTTTATTGATAGAAGAATCAAGG - Intronic
1197519245 X:127476668-127476690 TTTTAATCATAAAAGAATCCTGG - Intergenic
1198010226 X:132545022-132545044 TATTCTAGACAGAAGACTCCAGG + Intergenic
1198625933 X:138573999-138574021 TTTTATACATATAAGGATACTGG + Intergenic
1198925715 X:141792133-141792155 TTTTAAACAAAGAAAAATTCTGG + Intergenic
1199510437 X:148615685-148615707 TTTTATATACAAAAGAATAATGG - Intronic
1201546024 Y:15163363-15163385 TTTTGTACACAGACCAATACTGG + Intergenic