ID: 1087012950

View in Genome Browser
Species Human (GRCh38)
Location 11:93530543-93530565
Sequence CTGTGAGCATGAATGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087012950_1087012953 12 Left 1087012950 11:93530543-93530565 CCTGCTTTCATTCATGCTCACAG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1087012953 11:93530578-93530600 CTCCCATCTTACTAGAACAAAGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087012950 Original CRISPR CTGTGAGCATGAATGAAAGC AGG (reversed) Intronic
900087774 1:906639-906661 CTGTGGTCATGAAGGAGAGCCGG + Intergenic
900857826 1:5200192-5200214 CAGAGAGCAGGAATGAATGCTGG + Intergenic
902247567 1:15131089-15131111 CTGTGAGTCAGGATGAAAGCTGG - Intergenic
902545934 1:17190415-17190437 CGGTGGGCAGGCATGAAAGCCGG + Intergenic
903751023 1:25620767-25620789 AAATGAGCATGAATGAAAACTGG + Intronic
904495133 1:30882307-30882329 CTGTGAGGAAAAATGGAAGCAGG - Intronic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
905134729 1:35789794-35789816 CAGGGAGCAAGAGTGAAAGCAGG - Intergenic
907813215 1:57893124-57893146 CTGTGAGGATTAAATAAAGCAGG - Intronic
909541205 1:76793438-76793460 CTGGGAGAATGAATGAAGGGCGG + Intergenic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
911093414 1:94036075-94036097 CTGTCTGCATGAGTGACAGCTGG - Intronic
913415249 1:118598311-118598333 CTTTGAACATGTCTGAAAGCAGG + Intergenic
915683187 1:157602752-157602774 CTGCGAGCAGGAATAAAAGTAGG + Intergenic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
920304113 1:205007947-205007969 CTGGGAGCAGGAGTGGAAGCAGG + Intronic
1063513665 10:6672386-6672408 TTGTGAGCATGCATGAAAAATGG - Intergenic
1063973348 10:11396680-11396702 CTCTGAGCATGCGTGAAACCAGG - Intergenic
1065528417 10:26645540-26645562 CAGCCAGCATGAATGAAAGGTGG + Intergenic
1066124975 10:32332607-32332629 ATGTGAGCAAGACTGGAAGCAGG + Intronic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1071018619 10:81027232-81027254 CTGTGAGCTTTAATGCAAGAAGG + Intergenic
1071120051 10:82266430-82266452 CTGTGAGCAGTACTGAAGGCTGG + Intronic
1072756760 10:98026671-98026693 CTGTGAGCATGAGGGAGAGGAGG + Intronic
1073273254 10:102285330-102285352 CTGTGAGCAGGAAGATAAGCTGG - Intronic
1073764609 10:106668457-106668479 CTGGAAGCATGAATGAGAGGAGG - Intronic
1076726342 10:132415931-132415953 GTGTGAGCATGAATGTAAGAGGG - Intronic
1076787016 10:132755169-132755191 GTGTGAGCATGTGTGAGAGCAGG + Intronic
1077718654 11:4605524-4605546 CTCAGAACATGAATGAAACCAGG + Exonic
1077909132 11:6558851-6558873 CTGTGAGCTTGTAGGAAAACAGG - Intronic
1077911811 11:6578870-6578892 CTGAAAATATGAATGAAAGCAGG - Intronic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078661247 11:13288135-13288157 CTGTGTCCATGAATGCAAACTGG - Intronic
1080092487 11:28364874-28364896 TTTTGATCATGAAGGAAAGCTGG + Intergenic
1081514948 11:43819380-43819402 CTGTGACCATGAAGCACAGCAGG - Intronic
1081726579 11:45333971-45333993 CTGTTAGCATGAAAGAAAGGGGG + Intergenic
1081963372 11:47154524-47154546 CTGTGAACATGGATGCAAGGAGG + Intronic
1081994850 11:47357251-47357273 GTGTGAGCATGTATGTGAGCAGG - Intronic
1083647896 11:64183762-64183784 GAGGGAGCATGAAGGAAAGCGGG - Intergenic
1084403503 11:68958269-68958291 CTGTATGAATGAATGAAGGCGGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085844198 11:80046991-80047013 GTGAGAGCAGGAATGAAAGTTGG + Intergenic
1085852386 11:80137209-80137231 CATTGAGAATGAAAGAAAGCTGG - Intergenic
1086114631 11:83235095-83235117 CTGTGAGCCAGAATGAGATCTGG + Intronic
1087012950 11:93530543-93530565 CTGTGAGCATGAATGAAAGCAGG - Intronic
1087063976 11:94010276-94010298 CTGTGTCCATGATTGAAGGCTGG + Intergenic
1087715019 11:101597675-101597697 ACTTGAGAATGAATGAAAGCAGG - Intronic
1088742806 11:112780689-112780711 CTGTGAGGTTAAATGAGAGCTGG - Intergenic
1089034497 11:115372842-115372864 AGGTGAGCATGGATGAAAGAAGG + Intronic
1089133379 11:116229822-116229844 CAGTGAGCAGGAATCAAACCGGG + Intergenic
1090451237 11:126808186-126808208 CTGGGAGCATAAAGGAAAGAGGG + Intronic
1090883117 11:130852029-130852051 CTGTGAGCACGAAGGGGAGCAGG + Intergenic
1091323042 11:134665123-134665145 CTATGAGCAACAATGACAGCCGG + Intergenic
1091715640 12:2774425-2774447 CTGTGAGCATGATTTAAGCCTGG - Intergenic
1096519231 12:52174779-52174801 CTGTGAGCAGGAAAGAAAGCTGG - Intronic
1096886314 12:54722683-54722705 TTGGGAGAATGAATGAAAGGGGG - Intergenic
1097723850 12:63052198-63052220 GTGGGATCATGAATCAAAGCAGG - Intergenic
1099733202 12:86532485-86532507 CTGGGAGCATAAATTAATGCAGG + Intronic
1106900118 13:34347045-34347067 CTGTGACCATAAATGATATCAGG + Intergenic
1107541780 13:41395454-41395476 CAGTGAGAAGGATTGAAAGCGGG - Intergenic
1107571564 13:41664976-41664998 CTGTCAGCTTGAAGAAAAGCAGG - Intronic
1107703295 13:43072056-43072078 CTGTGAGTATGCAGGAATGCGGG - Intronic
1107810568 13:44196298-44196320 GAATGAGCAGGAATGAAAGCTGG - Intergenic
1107853558 13:44593012-44593034 CAGTGGGCATGAATGTCAGCAGG + Intergenic
1109651182 13:65329260-65329282 CTGTGAGCTTGCATTATAGCAGG - Intergenic
1110109513 13:71727157-71727179 ATGTGAGCCTTAATGAATGCAGG - Intronic
1111735019 13:92127178-92127200 ATGAAAGCGTGAATGAAAGCAGG + Intronic
1112974735 13:105303655-105303677 CTGTGGACATGAATGTGAGCTGG + Intergenic
1114831790 14:26152345-26152367 TTGTAAACATGAATGAATGCAGG - Intergenic
1115077896 14:29413901-29413923 CTCTGAGCATGAGCCAAAGCAGG + Intergenic
1115661925 14:35504274-35504296 ATGTGTGCATGCATGAAAGGTGG - Intergenic
1116130823 14:40854437-40854459 CTGGGCCCATGAATGTAAGCAGG + Intergenic
1121994791 14:98593428-98593450 CTGAGACCATGAATGGAGGCGGG - Intergenic
1123674345 15:22694021-22694043 ATGAAAGCATGAGTGAAAGCAGG + Intergenic
1123926700 15:25120004-25120026 CTGTGAGGCTGTAGGAAAGCTGG - Intergenic
1124326357 15:28767012-28767034 ATGAAAGCATGAGTGAAAGCAGG + Intergenic
1126798737 15:52281574-52281596 CTGTGTGCATGTTTGAAGGCAGG - Intronic
1128198483 15:65782384-65782406 CTGAGAGAATGAACGAAAGAGGG - Intronic
1128533433 15:68470958-68470980 CTGAGAGCATGAGGGAAGGCAGG - Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130683040 15:86013173-86013195 CTGTGTGGATAATTGAAAGCTGG + Intergenic
1131241417 15:90747026-90747048 CTGGAAGGATAAATGAAAGCTGG - Intronic
1134299039 16:12973152-12973174 TTGTTAGCAAGAATAAAAGCAGG + Intronic
1136096343 16:27959820-27959842 CAGGGAGCAAGAATGAAAGGAGG + Intronic
1137730384 16:50685311-50685333 TTGTGTGCATGAATGAATGGCGG + Intergenic
1139234202 16:65317470-65317492 CTGAAAGAATGAAGGAAAGCAGG - Intergenic
1146270662 17:31483279-31483301 CTGTGAGCATCAGTCAAACCTGG - Intronic
1146472536 17:33135869-33135891 CAGTGAGCTGGAATGCAAGCTGG + Intronic
1150933436 17:69610245-69610267 CAGAGAGAATGAATGCAAGCAGG + Intergenic
1151011883 17:70508720-70508742 CTGTGAACCTTATTGAAAGCTGG + Intergenic
1152032294 17:77851488-77851510 CTGTGAGCATCAGTGCAAGGTGG + Intergenic
1155370574 18:25096122-25096144 CTGTGAACATAAATGTAAACAGG + Intronic
1156057226 18:33021613-33021635 CTTGGATCAAGAATGAAAGCAGG - Intronic
1159513325 18:69425069-69425091 TTGTGAGCAGGACTGGAAGCAGG + Intronic
1160450605 18:78963035-78963057 GTGTGAGCATGTATGTGAGCGGG - Intergenic
1162550725 19:11356988-11357010 CTGGGAGAATGGATGCAAGCAGG + Intronic
1166246441 19:41530450-41530472 CTGTGAGGAGATATGAAAGCTGG - Intergenic
1166510606 19:43406425-43406447 CTCTGAGCCTGATTGAAAGGCGG + Exonic
1168209705 19:54881573-54881595 CTGGAAGCATGAATGAAGGCCGG + Intronic
925310630 2:2879103-2879125 CTGTGAGCATGACTGAGAACTGG + Intergenic
925683266 2:6445338-6445360 TGGTGGACATGAATGAAAGCCGG + Intergenic
925720422 2:6821416-6821438 CTGTGAGCCTGAGGGAAGGCGGG + Intergenic
926989531 2:18662723-18662745 CTGAGAGGGTGAATGGAAGCTGG + Intergenic
928063090 2:28134797-28134819 CTGTCAGCATAAATGAAATGTGG + Intronic
928337241 2:30408354-30408376 ATGTGAGCATGAAGGAAATTGGG + Intergenic
929143949 2:38690067-38690089 ATGTTAGCATGAGGGAAAGCTGG + Intronic
929882310 2:45847674-45847696 CTGGGGCCATGAATGGAAGCAGG - Intronic
929906301 2:46049362-46049384 CTGTGGGCATGAGAGAGAGCTGG - Intronic
931182105 2:59913015-59913037 GTGTGAGCATGCATCATAGCAGG + Intergenic
931772775 2:65512997-65513019 CTGTGACCATGCAAGAAAGAAGG + Intergenic
935549613 2:104438672-104438694 CTGTGGCCAGGAATGCAAGCAGG + Intergenic
937033194 2:118758303-118758325 ATGAGAGTATGAGTGAAAGCAGG - Intergenic
937756816 2:125549525-125549547 ATGGAAGCATGAATGAAACCTGG + Intergenic
938784240 2:134610547-134610569 CTGGGCAGATGAATGAAAGCAGG - Intronic
938970022 2:136423544-136423566 CTGTGCGCCTGAAAGAAAGGCGG - Intergenic
940839882 2:158567949-158567971 GTTTGAGCCTGAATGAAAGAGGG + Intronic
941616966 2:167731658-167731680 CTGTGTGAATGAAGGAAACCAGG + Intergenic
941934923 2:170974740-170974762 CTGTGAGCAGGAGGGAAAGGCGG + Intergenic
943817876 2:192278755-192278777 CTGTGAGCATGTACATAAGCAGG + Intergenic
947227748 2:227856712-227856734 CTGTGAGAAAGAATGGGAGCAGG - Intergenic
1168853690 20:993860-993882 CTGTGAGGATGAAATAAGGCTGG + Intronic
1168904163 20:1390793-1390815 CTGTGAGCATGAGGCAGAGCTGG + Intronic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171989415 20:31684397-31684419 CTGAGAGCAGAAATGAAAACAGG + Intronic
1172499889 20:35418235-35418257 CTTTCTGCATGAATGAAACCTGG - Intergenic
1173570804 20:44074920-44074942 CTATGAGCAAGAATAAAAGGAGG + Intergenic
1174560651 20:51428516-51428538 CTGTGTGCAGGAATGCAGGCGGG + Intronic
1177618106 21:23551324-23551346 AAATGAGCATTAATGAAAGCAGG - Intergenic
1178575511 21:33785301-33785323 CTCTGAGCATGCATCAAAGTAGG - Intronic
1180060045 21:45380199-45380221 CTGTGTGCATGGATGGACGCTGG - Intergenic
1181658870 22:24325655-24325677 CTGTGGCCATGAATGAAAAAAGG + Intronic
1181706052 22:24649979-24650001 CTGTCACCATGACTGACAGCAGG + Intergenic
1182710231 22:32318017-32318039 CTGTGAGGATGAGTGAAAGGGGG - Intergenic
1184328653 22:43811777-43811799 CTGTGGGCACAAATGAAATCAGG + Intronic
1184397797 22:44254971-44254993 CTGGGAGGATGAGTGAAAGGGGG - Intronic
1184955125 22:47880923-47880945 CTCTGAACAGGATTGAAAGCGGG + Intergenic
949275143 3:2270547-2270569 CTCTGAGAATGAAGGAAAGTAGG - Intronic
949385692 3:3499929-3499951 CAGTGAAGATGAATGAAAACTGG + Intergenic
950471361 3:13188593-13188615 CAGTGAGCATGGTTCAAAGCTGG - Intergenic
951173600 3:19572941-19572963 GTGTGTGCATGAATGAATGCAGG - Intergenic
951625087 3:24651582-24651604 CTGTAAGTATGAATGAGAGCAGG - Intergenic
952168526 3:30778562-30778584 CTCTGAGCATGTATGTAAGCAGG - Intronic
952901734 3:38115641-38115663 CTGCGAGCAGGACTGAAGGCAGG + Intronic
954173114 3:48821303-48821325 CTGGGAGCATGAAGCAAAGCTGG - Intronic
954874359 3:53791771-53791793 CTCTGAGCACGAATTAAAGACGG - Intronic
956025212 3:64976158-64976180 CTGTGAGGTTCACTGAAAGCTGG - Intergenic
956616121 3:71174543-71174565 CTGTGAAGATGGATGAAATCAGG - Intronic
956924286 3:73966982-73967004 CTGTCAGAATAGATGAAAGCAGG - Intergenic
962867682 3:139461124-139461146 CACTGAGCATGAATGTGAGCAGG + Intronic
969361226 4:6665104-6665126 ATGTGAGCATGAGTGTCAGCGGG - Intergenic
970187956 4:13483289-13483311 CTGTTCGAATGAATGAATGCGGG - Intronic
970347852 4:15170824-15170846 CTGTCAGGAAGTATGAAAGCAGG + Intergenic
973288135 4:48442407-48442429 CTGGCAGCATGATTGACAGCTGG - Intergenic
973553143 4:52055303-52055325 AAGTGGGCATGAATGAAGGCAGG - Intronic
973816958 4:54627798-54627820 CTCTTAGCAAGAATGCAAGCAGG + Intergenic
974175092 4:58311305-58311327 CTCTGAGGATGAATCAAAGATGG - Intergenic
975459063 4:74629324-74629346 CTGTGTGCATGAAGGAATGAAGG - Intergenic
977431873 4:96940275-96940297 CTGTTTGCCTGAATGGAAGCTGG - Intergenic
979743185 4:124177291-124177313 CTCTGAGCTTGACTGAAAGTTGG - Intergenic
983262268 4:165470158-165470180 TTTAGAGCATGAATGAAAGGAGG + Intronic
983302440 4:165944647-165944669 ATGTGGGCAAGAATGAAACCAGG + Intronic
984624934 4:181996352-181996374 CTGTGAGCAGGAATGGATGATGG + Intergenic
987811525 5:22842355-22842377 CTGTAAACATGAATGACAGTAGG + Intronic
988657818 5:33231698-33231720 CTGATAGAATGAATGAATGCAGG - Intergenic
990376377 5:55174285-55174307 CTTTCAGTATGAAGGAAAGCAGG - Intergenic
991632516 5:68670657-68670679 CTCTGAGCATTAATAAAACCAGG + Intergenic
992033953 5:72752731-72752753 CTGTGGGCATGCATGAAGCCAGG + Intergenic
993216780 5:85034551-85034573 ATGAGAGCATGAATGAATGATGG + Intergenic
993370282 5:87084580-87084602 CAGTGAGCATGAGCGAAAGCAGG + Intergenic
995622412 5:114040368-114040390 CTGTGAGCTTGAATTCAAGAAGG - Intergenic
995665462 5:114536618-114536640 CAGTGAGCATGAGCCAAAGCAGG - Intergenic
996382178 5:122873449-122873471 CTGTGAGCATGTTTGCATGCTGG + Intronic
997028082 5:130090011-130090033 CTAGGAGCATGAAGGAAAGAAGG - Intronic
997045857 5:130316832-130316854 AACTGAGCATGAATTAAAGCAGG + Intergenic
997139044 5:131359486-131359508 CTGTAAGCATGAGTGAATTCTGG + Exonic
997237362 5:132280607-132280629 CTGTGAGCATGCTTGCAACCAGG + Intronic
1000837319 5:166171897-166171919 CAGTAAGCATGACTGAAAGATGG + Intergenic
1000978405 5:167790146-167790168 CTCTGTGCAGGAATCAAAGCCGG - Intronic
1001871968 5:175164062-175164084 TTGTGAGCATTACAGAAAGCAGG + Intergenic
1001896576 5:175387392-175387414 CTGTTAGAATGAATGCATGCTGG - Intergenic
1001966585 5:175914052-175914074 GTGTCAGCCTGAATGAAGGCAGG - Intergenic
1002250362 5:177925152-177925174 GTGTCAGCCTGAATGAAGGCAGG + Intergenic
1002328268 5:178424194-178424216 CAGTGTGAATGAATGAATGCAGG - Intronic
1003679853 6:8242146-8242168 CTGTTAGCTTGAGTGAAATCTGG + Intergenic
1003777790 6:9388759-9388781 CTGTGAGCAGAGTTGAAAGCAGG - Intergenic
1004478595 6:15997897-15997919 GTGTGAGCATGAGAGTAAGCTGG + Intergenic
1006925176 6:37650055-37650077 CTGGGAGCCAGAAGGAAAGCTGG + Intronic
1007224254 6:40301860-40301882 TGGTGACCATGAATGACAGCTGG - Intergenic
1008297000 6:49790668-49790690 CTGTGAACATAGATGAAAACTGG - Intergenic
1008715550 6:54284852-54284874 CTGTGTGCATTGATGAAATCTGG - Intergenic
1011714718 6:90093198-90093220 CTGTTAGCAAGACTGACAGCTGG - Intronic
1013751088 6:113407024-113407046 CTGAGAGAATGATTTAAAGCAGG - Intergenic
1014814944 6:125925041-125925063 CTGTGAGCTGAAATGAGAGCAGG - Intronic
1016468133 6:144347144-144347166 CTGTCAGCAGGCAAGAAAGCAGG - Intronic
1017397714 6:154022173-154022195 TTCTGATCATGAATGAGAGCTGG + Intronic
1019601792 7:1887667-1887689 GTGTGAGCATGAATGCATGTGGG + Intronic
1020326398 7:6977828-6977850 CAGTGAGCATGAGTCCAAGCAGG - Intergenic
1022584911 7:31599433-31599455 CTCTGGACATGAATGAAAGGAGG + Intronic
1022654520 7:32306557-32306579 CTTGGAGCAAGAATGCAAGCTGG - Intergenic
1024100645 7:46029288-46029310 CTGTTAGCATGAAGGTATGCTGG + Intergenic
1024166901 7:46743284-46743306 CTGATAGCAGGAATGAAAGAGGG - Intronic
1027250669 7:76396905-76396927 CTGTGAGCATCAGAGAATGCTGG + Intronic
1028320333 7:89451423-89451445 CTGTAAGAATAAATTAAAGCAGG + Intergenic
1029160996 7:98551787-98551809 CTGTGGGCATGAATGAATAATGG + Intergenic
1031262699 7:119542088-119542110 CTGTGAATATGAATGCAACCTGG - Intergenic
1031383756 7:121120135-121120157 CAGTCAGCATAACTGAAAGCAGG - Intronic
1035819405 8:2576379-2576401 CTGTGAGAAAGCATGAAAGACGG - Intergenic
1036127577 8:6077152-6077174 CTGTGTGCATGTATGAATGCAGG + Intergenic
1036954758 8:13175851-13175873 CTGTGACCAGGAAGGAAAGCAGG - Intronic
1037849747 8:22317287-22317309 CTGTTAATATGAATAAAAGCTGG - Intronic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1040311223 8:46237860-46237882 CTGTGAGAATGCAGGAATGCTGG + Intergenic
1048116119 8:131525028-131525050 CTTTGAGAATGAATGAAACTGGG + Intergenic
1048965921 8:139614433-139614455 CTGTGACCATGCCTGAATGCAGG + Intronic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1050439574 9:5647611-5647633 CTGTTAGAATGAATGAATTCAGG - Intronic
1051392584 9:16581842-16581864 CTGTGGGCATGAAGGACTGCAGG + Intronic
1051506527 9:17832885-17832907 CTGTGAGCATGTGGCAAAGCTGG - Intergenic
1052837040 9:33258604-33258626 CTGTGAGCATAAATGGATGCTGG + Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1059217520 9:112579909-112579931 GTCTGAGCCTGAGTGAAAGCTGG - Intronic
1059633736 9:116153356-116153378 TTTTGAGCAGGAATGAGAGCTGG + Intergenic
1059941322 9:119362621-119362643 TTGTGAAAAAGAATGAAAGCTGG - Intronic
1060162469 9:121377991-121378013 TTCTGATCATGAATGAGAGCTGG - Intergenic
1061245125 9:129397634-129397656 ATGGGAGCATGAATGAAGGATGG + Intergenic
1185701486 X:2234159-2234181 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701497 X:2234235-2234257 CTGTGTGCATGGATGCAGGCAGG - Intronic
1185701508 X:2234311-2234333 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701518 X:2234369-2234391 CTGTGTGCATGGATGAAGGCAGG - Intronic
1186621559 X:11246318-11246340 ATGAGACCATCAATGAAAGCTGG + Intronic
1194589771 X:95785639-95785661 CTGTAAGAATGTATGAAAGCAGG + Intergenic
1195748086 X:108138365-108138387 CTGTGTGCCTGATGGAAAGCAGG + Intronic
1196596558 X:117552660-117552682 CAGTGAAAATGAATGAAGGCTGG + Intergenic
1197929104 X:131677738-131677760 ATGTGAGAAGGAATGAAGGCTGG - Intergenic