ID: 1087013977

View in Genome Browser
Species Human (GRCh38)
Location 11:93538590-93538612
Sequence CTCTGCTAACAGCTAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087013977_1087013980 -3 Left 1087013977 11:93538590-93538612 CCTTTCTCTAGCTGTTAGCAGAG 0: 1
1: 0
2: 0
3: 11
4: 184
Right 1087013980 11:93538610-93538632 GAGACCAAAGGAGGCACTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087013977 Original CRISPR CTCTGCTAACAGCTAGAGAA AGG (reversed) Intronic
900005030 1:39531-39553 TTCTGCTTACAACCAGAGAAGGG - Intergenic
903317333 1:22518566-22518588 ATCTGCCAACAGCTAGAAACTGG - Intronic
904749694 1:32733876-32733898 GTCTGCAAACACCTAGAGAGGGG + Intergenic
907583289 1:55591516-55591538 CTCTGCCAACAGCTTGATCATGG - Intergenic
910444567 1:87287071-87287093 GTCTGCTAAAAACTAGAGAGTGG - Intergenic
913404184 1:118470544-118470566 CTCTCATAACAAATAGAGAATGG - Intergenic
914868614 1:151454750-151454772 CTCTGCTAACACCTAGCAATAGG + Intronic
915206166 1:154272022-154272044 CTCTGCAACCAGCAAGACAAAGG - Intergenic
916442506 1:164841490-164841512 CTCTGGTGGCAGCTAGAGATAGG + Intronic
920854244 1:209650617-209650639 CTCTGGAACCAGCTTGAGAAAGG + Intronic
923260268 1:232261586-232261608 CTGTGCTAACAGCTTCACAAGGG + Intergenic
923297256 1:232606051-232606073 CTTTTGTAACAGCAAGAGAAAGG + Intergenic
923729568 1:236537321-236537343 CTATTCAAACAGCTAGAAAAAGG - Intronic
924017995 1:239748821-239748843 CTCTGCATAAATCTAGAGAAGGG - Intronic
1068275702 10:54792941-54792963 CTCTGCTAACAGCATGATATGGG - Intronic
1068738259 10:60439263-60439285 TTCTGTGAACTGCTAGAGAAGGG + Intronic
1068903933 10:62301449-62301471 CTCTATTAACAGCATGAGAATGG + Intergenic
1070510350 10:77155212-77155234 CCCTGCAAACAACTAAAGAAAGG + Intronic
1073733611 10:106320508-106320530 CTCTGCTAAGAGCTAAACACTGG + Intergenic
1074928569 10:118099767-118099789 CTCTACTAACATCTTGGGAATGG - Intergenic
1076648691 10:131972239-131972261 TTCTGTTAACAGCTATTGAATGG - Intronic
1077207087 11:1349892-1349914 CTCTGGGAACAGCTGGGGAAAGG - Intergenic
1077303998 11:1859765-1859787 CACTGCTGACAGCAGGAGAATGG - Intronic
1079535105 11:21504744-21504766 CTCTGCTTCGAGCTAGTGAATGG - Intronic
1081417897 11:42837543-42837565 CTCTGATTATAGCCAGAGAAAGG - Intergenic
1082781921 11:57294656-57294678 CTCTGCCAACATCTGGGGAATGG - Intergenic
1084958600 11:72704312-72704334 CTCTTCTTACAGCTGGGGAATGG - Exonic
1084982648 11:72839396-72839418 CTCAGGTAACAACTGGAGAAAGG + Intronic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1090994407 11:131852458-131852480 ATCTTCTAAAACCTAGAGAAAGG - Intronic
1091379012 12:43710-43732 TTCTGCTTACAACCAGAGAAGGG - Intergenic
1092054224 12:5495805-5495827 CTCTGCTCACAGCTCTAGAAGGG - Intronic
1100062933 12:90603819-90603841 CTCTGATAACAGGTAGAAATAGG + Intergenic
1103118784 12:118362705-118362727 TGTTGCTAATAGCTAGAGAAAGG + Intronic
1103897899 12:124286101-124286123 CTCTGCAAAGAGCCTGAGAAAGG - Intronic
1104095966 12:125558277-125558299 CTCTTCTCCCACCTAGAGAAGGG + Intronic
1106850607 13:33786676-33786698 CTCTGCTAGCTGGTAGAGTAGGG - Intergenic
1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG + Intergenic
1108948480 13:56055625-56055647 TTCTGGTAACAGCAATAGAAGGG - Intergenic
1108948915 13:56062243-56062265 CTCTTCAAACACCTAGTGAAAGG - Intergenic
1111105030 13:83634044-83634066 CTTTGCTAACAGACAGGGAAAGG - Intergenic
1111422957 13:88041238-88041260 TTCTGCAAACAGTTAGACAATGG - Intergenic
1112035179 13:95490832-95490854 CTCTGCTAACAGCACTAGACAGG - Intronic
1112783160 13:102924201-102924223 CTATGCTCAGTGCTAGAGAAGGG - Intergenic
1113970719 13:114186166-114186188 CTCTGCTGAGAGCTGAAGAAAGG + Intergenic
1116187944 14:41623005-41623027 CTATGCTTACAGTTAGAGGAAGG + Intronic
1119228025 14:72958916-72958938 CTCTCCTAGCAGCCAGAGGATGG - Exonic
1119897749 14:78234220-78234242 CTCTATTAGCAGCTTGAGAATGG + Intergenic
1122509095 14:102251355-102251377 CTCTGCTGACAGCCAGTGACAGG + Intronic
1124985439 15:34606005-34606027 CTCTACTAAGACCCAGAGAAAGG + Intergenic
1128003542 15:64216969-64216991 CACTGCTATAAGATAGAGAATGG + Intronic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1129240092 15:74245805-74245827 CGCTGCTCCCAGCTGGAGAAGGG - Intronic
1130162899 15:81419383-81419405 ATCTGCTAAAAGCAAGAAAAAGG + Intergenic
1131144096 15:90000611-90000633 CTCTGCTAACAGCTGTTTAAAGG + Intergenic
1131604748 15:93889669-93889691 TTCTGCCAACAGCCAGAGGAGGG + Intergenic
1132448482 15:101951413-101951435 TTCTGCTTACAACCAGAGAAGGG + Intergenic
1134618906 16:15672891-15672913 CTCTGCTTACAGCCAGGAAATGG + Intronic
1135980371 16:27142418-27142440 CTCTGGTTAGAGCCAGAGAAAGG - Intergenic
1137849881 16:51731177-51731199 CTCTTCTAATAGCTACAAAAGGG + Intergenic
1140153399 16:72396516-72396538 CTCTGGTAATTGCTGGAGAAAGG - Intergenic
1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG + Intergenic
1141932538 16:87215748-87215770 CTCTCCTAACACCTGCAGAAAGG - Intronic
1142778029 17:2156972-2156994 CTTTGCTAACAGTAAGGGAAGGG + Intronic
1144666287 17:17104597-17104619 CTCTGCTAGCAGCCAGGGGAAGG - Intronic
1147757462 17:42778491-42778513 CCCAGCTAAAAGCTAGAAAAAGG + Intronic
1148701721 17:49591320-49591342 CTCTCCTCACATCTAGAGAGAGG + Intergenic
1151178953 17:72311986-72312008 CTCTGCTAACAGACAGGGGAGGG + Intergenic
1157349130 18:46869320-46869342 CTCAGCAAACCTCTAGAGAAGGG + Intronic
1160636783 19:81140-81162 TTCTGCTTACAACCAGAGAAGGG - Intergenic
1161617497 19:5280135-5280157 CTCTACGACCAGCTAGAAAAGGG + Intronic
1165102317 19:33446275-33446297 CTCTTCTTAAAGCTGGAGAAAGG - Intronic
1166157355 19:40924046-40924068 CCCTGCCAACATCTAGAGAGTGG + Intergenic
925442882 2:3903605-3903627 CTCTGTGCACAACTAGAGAAAGG - Intergenic
925853628 2:8108161-8108183 CTCTGCTGACACCTAGGGAAAGG - Intergenic
926564008 2:14450010-14450032 GTCTCCTGACAGCTGGAGAATGG - Intergenic
926893550 2:17659779-17659801 CTCTGCTAACAGCTTCTGCAAGG + Intergenic
927137093 2:20105156-20105178 CTTTGCTAACTGCCAGAGTAAGG + Intergenic
927144018 2:20149168-20149190 CTCTTGTAACAGTTAGGGAATGG - Intergenic
927646530 2:24880541-24880563 TTCTGCTAAGAGCTTGACAAGGG - Intronic
928349520 2:30536371-30536393 TTCTATGAACAGCTAGAGAAAGG + Intronic
930766888 2:55093742-55093764 CTCTGATTACAGCCAGAGGAAGG + Intronic
931379406 2:61738292-61738314 ATTTGCTAACAGCTAGTAAATGG - Intergenic
933985188 2:87584748-87584770 CTCTGCCTACAGTTAGAGGAAGG - Intergenic
934908653 2:98229590-98229612 CACTTATAAAAGCTAGAGAAAGG - Intronic
936564693 2:113573901-113573923 TTCTGCTTACAACCAGAGAAGGG + Intergenic
936758028 2:115737904-115737926 CTCTGCATAGAGGTAGAGAAAGG - Intronic
937656122 2:124378833-124378855 CTCTGTTTACATCTTGAGAAAGG + Intronic
943023445 2:182601758-182601780 CTCTGCTAAGAGCTGCAGAGAGG - Intergenic
945742933 2:213685464-213685486 CTCTGCTAACACCTTGAGTTTGG + Intronic
945755409 2:213839863-213839885 TCCTGCTAACAGCTGTAGAAAGG + Intronic
947445897 2:230162352-230162374 TTCTGCTATCAGCTAGAGGGGGG + Intergenic
947707150 2:232285509-232285531 CTCTGTTAGAATCTAGAGAAGGG + Intronic
948724502 2:239924526-239924548 CTCGGCAAACAGGTAGAGAGAGG + Intronic
1169157366 20:3343133-3343155 GTCTGCTAAAATCTAAAGAAAGG - Intronic
1169572779 20:6924602-6924624 TTCTGGTAAAAGCCAGAGAAAGG + Intergenic
1172400183 20:34643966-34643988 CTTTACTAACAGATAAAGAAGGG - Intronic
1174175050 20:48639309-48639331 CTCTGCTTCCAGCTTGACAAAGG - Intronic
1175366420 20:58459494-58459516 CTGTGATAAGAGCTAGAGATAGG + Exonic
1176012543 20:62906965-62906987 CTCAGCTAACGGGCAGAGAAGGG + Intronic
1184734448 22:46389990-46390012 CACTGCTGACAGCTAGACCATGG + Intronic
950237955 3:11340163-11340185 ATCTGCTCACAGGTACAGAAGGG + Intronic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
951424668 3:22530115-22530137 CACTGGTAACTGCTAGACAAGGG + Intergenic
953778515 3:45844033-45844055 CTCTGCTAAAAGGTAAAAAATGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956280354 3:67549811-67549833 CTCTGATTACTGGTAGAGAAAGG + Intronic
956655232 3:71543419-71543441 CACTGCTAACAGCCAGAGGTTGG - Intronic
956989295 3:74744787-74744809 CTCTATTTACAGCTAGAAAAGGG - Intergenic
957619773 3:82580339-82580361 CTCTGCTTTCAGAAAGAGAAAGG - Intergenic
964198036 3:154087263-154087285 CTATGCCAACAGCTAGACCATGG - Intergenic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
967749461 3:193097239-193097261 CACTGTTAATAGCTAGAGCAAGG + Intergenic
968673773 4:1866045-1866067 CTCTGCTTCCCACTAGAGAAGGG - Intergenic
969705965 4:8791791-8791813 CTCTTCTCACAGCCAGGGAAGGG + Intergenic
969985849 4:11209891-11209913 CTCTGCAAACAGCCAGAAACAGG - Intergenic
970213470 4:13734342-13734364 AACTGTTAACAGCTATAGAAAGG - Intergenic
970404625 4:15750464-15750486 CTCTGCTTAGAACTAGAGAGAGG + Intergenic
971121933 4:23714195-23714217 CTCTGCTACCAGCTGGTGAGTGG + Intergenic
974315618 4:60276304-60276326 TTCTGCTAATATCTAGAAAAAGG - Intergenic
974558166 4:63479042-63479064 CACTGTTAACAGCAAGAGAAAGG - Intergenic
977263391 4:94825169-94825191 TGCTGCTAACAGCCAGAGGATGG - Intronic
978135392 4:105251758-105251780 CTCTTCCAAAAGATAGAGAAGGG - Intronic
978679227 4:111358296-111358318 CTATGCTAAAATATAGAGAATGG - Intergenic
979097142 4:116564855-116564877 CTCTACTAAAAGACAGAGAATGG + Intergenic
980899302 4:138889185-138889207 CTCTGCCACCAGATAGACAATGG + Intergenic
987467147 5:18285515-18285537 CTCTTCTAACAGTGAGAAAATGG - Intergenic
990168580 5:53021701-53021723 CTGTGCTCACAGTTAGAGATAGG + Intronic
990247940 5:53881936-53881958 TTCTGCTAACTACTAGATAATGG - Intergenic
994234682 5:97348200-97348222 CTATTCTAACAAATAGAGAAGGG - Intergenic
994658919 5:102629887-102629909 CTCTGGTAATGGCAAGAGAATGG - Intergenic
994851282 5:105057585-105057607 CTCTGCTGAGAGCTATAGAGAGG + Intergenic
995039784 5:107574497-107574519 ATCTGCTACCATCTGGAGAATGG - Intronic
995530643 5:113088732-113088754 CTCTGCTAACACCTTGAGTTTGG + Intronic
995647055 5:114324826-114324848 TTCTGCTAACAGCCTGTGAAAGG - Intergenic
996572027 5:124942124-124942146 CTCTGCTGAAAGTAAGAGAAGGG - Intergenic
998286701 5:140869732-140869754 TGCTGCTAACAGCTACAGACGGG + Exonic
998508153 5:142688875-142688897 CTCTCCTAAGAGCTTTAGAAGGG + Intronic
998641676 5:144018641-144018663 CCCTGCTAACTGCTAGAAAAGGG + Intergenic
998993446 5:147844507-147844529 CTATCATAAAAGCTAGAGAATGG - Intergenic
1000153418 5:158526520-158526542 CTCCTCTGACTGCTAGAGAAGGG + Intergenic
1000765227 5:165280951-165280973 CTCTGCTATAAGCAAGAGACTGG - Intergenic
1002153648 5:177257579-177257601 CTCTGATAAAAGCTAGAGAGAGG - Intronic
1003159939 6:3626044-3626066 CTCTGCTGAATGCAAGAGAAGGG - Intergenic
1003281584 6:4697265-4697287 CTTTGTTAGCAGCTTGAGAATGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007114791 6:39335820-39335842 CTCTGCTGAGAGCTTGAGAGAGG - Exonic
1009506778 6:64493334-64493356 ATCTGCTCACATCTAGAAAAGGG + Intronic
1010466574 6:76174038-76174060 CTGTGTTAACAACTAGAAAATGG - Intergenic
1010873289 6:81068774-81068796 CTCTCTTTACAGCTTGAGAATGG - Intergenic
1011809194 6:91110611-91110633 CTGTGTTAACAGGTAGAGCATGG - Intergenic
1017525037 6:155234952-155234974 CTGTGCGGACAGCTAGAGAGGGG + Intronic
1018693028 6:166364260-166364282 ATCTGCTACCACATAGAGAATGG + Intergenic
1019108533 6:169690495-169690517 CTCTGCTGAGACCTGGAGAATGG - Intronic
1019309777 7:354364-354386 CTCTGTCAACAGCTCTAGAAAGG + Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021919205 7:25466725-25466747 CTCTGCTATCAGCCAGAGGAGGG + Intergenic
1022400525 7:30032055-30032077 ATCTTCTAACATCTAAAGAAAGG - Intronic
1024402833 7:48944875-48944897 CTCTTTTAACAGCTTGAGATAGG + Intergenic
1028024624 7:85821572-85821594 CTCTGCTGAGAGCTACAGAGAGG + Intergenic
1028576247 7:92355092-92355114 CTTTGTGAACAGGTAGAGAAGGG - Intronic
1028657163 7:93221572-93221594 CTCTACTAATAGCTAGCCAAAGG - Intronic
1032598939 7:133272281-133272303 CACTCCTAACAGCTACAGAGTGG - Intronic
1032660405 7:133977551-133977573 CTTGGCTCACAGCTAGAGAGTGG + Intronic
1035080560 7:156212542-156212564 CTCTCCTAACAGCTAGAATGTGG + Intergenic
1035764558 8:2095703-2095725 TTCTCCTAACAGGTCGAGAACGG - Intronic
1037054310 8:14419274-14419296 ATGTCCTAACAGCTAGATAATGG + Intronic
1044675837 8:94727855-94727877 CACTGTTATCAGTTAGAGAATGG + Intronic
1045116372 8:98986857-98986879 CTCTGCTAACATTTTGGGAAAGG - Intergenic
1046783169 8:118237514-118237536 CTCTTCTTACAGCTGGGGAAAGG - Intronic
1047457563 8:125029945-125029967 CTCTGCTTGGAGCAAGAGAAAGG + Intronic
1047505828 8:125479250-125479272 CTCATCTAACAGCTGGAGAGAGG - Intergenic
1047741598 8:127811091-127811113 CTCTGATAACATCTAGAAGAGGG - Intergenic
1047963381 8:130027236-130027258 CTATTCTCACAGCTAGAGAATGG + Intergenic
1049887724 9:39313-39335 TTCTGCTTACAACCAGAGAAGGG - Intergenic
1050423361 9:5489974-5489996 CTCCTCTCACAGGTAGAGAAAGG - Intergenic
1050441670 9:5670474-5670496 CTCTCCCAACAGCTAGAAAAAGG - Intronic
1051995435 9:23210261-23210283 CTCTTCTAGCAGATAGAGAAGGG - Intergenic
1052515604 9:29475417-29475439 CTCTGCTAACAGGTAGATTCTGG - Intergenic
1053295201 9:36907818-36907840 CTCTGATGACATCTACAGAATGG + Intronic
1055167354 9:73212931-73212953 CTCTTCTGACAGCTGGAGACAGG + Intergenic
1055325818 9:75128073-75128095 CTCTCCTTCCACCTAGAGAAAGG - Intronic
1056711112 9:88992218-88992240 CTGAGATAACAGCTAGAGAAGGG + Exonic
1057546682 9:96024257-96024279 CTCTGCTAAAGGGTGGAGAAAGG - Intergenic
1185481538 X:450134-450156 CTCAGCCAACAGATAGAGATGGG + Intergenic
1185481565 X:450289-450311 CTCAGCCAACAGATAGAGATGGG + Intergenic
1185481591 X:450444-450466 CTCAGCCAACAGATAGAGATGGG + Intergenic
1185481615 X:450599-450621 CTCAGCCAACAGATAGAGATGGG + Intergenic
1186108326 X:6228829-6228851 CTGTGCTAAGAGACAGAGAAGGG + Exonic
1187244240 X:17539568-17539590 ATGTGCTAGGAGCTAGAGAAGGG - Intronic
1187511756 X:19925923-19925945 CTCTCCTAACCTTTAGAGAAAGG - Intronic
1190503262 X:51099870-51099892 ATCTGCTAAGGGCCAGAGAAGGG + Intergenic
1191067483 X:56366001-56366023 CTCTGCTAACAGCACTAGACAGG - Intergenic
1194528745 X:95016095-95016117 CTGTCCCAACAGCTAGAGAGAGG - Intergenic
1197295401 X:124712981-124713003 CTCTACTAACAACTATATAAAGG + Intronic
1199461638 X:148091949-148091971 CTCTGCAAACTACTAGAGCAAGG - Intergenic