ID: 1087019195

View in Genome Browser
Species Human (GRCh38)
Location 11:93585437-93585459
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087019188_1087019195 17 Left 1087019188 11:93585397-93585419 CCTGTAATCCCAGCTACTCGGGA 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
Right 1087019195 11:93585437-93585459 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1087019191_1087019195 8 Left 1087019191 11:93585406-93585428 CCAGCTACTCGGGAAGCTGAGGC 0: 3119
1: 106508
2: 267490
3: 216129
4: 132032
Right 1087019195 11:93585437-93585459 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1087019189_1087019195 9 Left 1087019189 11:93585405-93585427 CCCAGCTACTCGGGAAGCTGAGG 0: 3428
1: 113806
2: 295317
3: 221296
4: 121327
Right 1087019195 11:93585437-93585459 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087019195 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intergenic
Too many off-targets to display for this crispr