ID: 1087020608

View in Genome Browser
Species Human (GRCh38)
Location 11:93598968-93598990
Sequence AATCAGAAGTATACCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087020608_1087020610 4 Left 1087020608 11:93598968-93598990 CCTTCCACGGTATACTTCTGATT No data
Right 1087020610 11:93598995-93599017 TGTTCAAAGCCAATACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087020608 Original CRISPR AATCAGAAGTATACCGTGGA AGG (reversed) Intergenic
No off target data available for this crispr