ID: 1087022257

View in Genome Browser
Species Human (GRCh38)
Location 11:93615392-93615414
Sequence CTGTGAGTGTTTGAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087022257_1087022265 18 Left 1087022257 11:93615392-93615414 CCCACTCCCTCAAACACTCACAG No data
Right 1087022265 11:93615433-93615455 AAACTTTCCCTATTTCAGCCTGG No data
1087022257_1087022266 19 Left 1087022257 11:93615392-93615414 CCCACTCCCTCAAACACTCACAG No data
Right 1087022266 11:93615434-93615456 AACTTTCCCTATTTCAGCCTGGG No data
1087022257_1087022270 27 Left 1087022257 11:93615392-93615414 CCCACTCCCTCAAACACTCACAG No data
Right 1087022270 11:93615442-93615464 CTATTTCAGCCTGGGGTGTCTGG No data
1087022257_1087022267 20 Left 1087022257 11:93615392-93615414 CCCACTCCCTCAAACACTCACAG No data
Right 1087022267 11:93615435-93615457 ACTTTCCCTATTTCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087022257 Original CRISPR CTGTGAGTGTTTGAGGGAGT GGG (reversed) Intergenic
No off target data available for this crispr