ID: 1087023087

View in Genome Browser
Species Human (GRCh38)
Location 11:93622609-93622631
Sequence CAGCCAGATGTGGTGCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087023087_1087023089 -10 Left 1087023087 11:93622609-93622631 CCAAACAGCACCACATCTGGCTG No data
Right 1087023089 11:93622622-93622644 CATCTGGCTGAAGAACTGCCTGG No data
1087023087_1087023091 9 Left 1087023087 11:93622609-93622631 CCAAACAGCACCACATCTGGCTG No data
Right 1087023091 11:93622641-93622663 CTGGCCAACCCACAAAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087023087 Original CRISPR CAGCCAGATGTGGTGCTGTT TGG (reversed) Intergenic
No off target data available for this crispr