ID: 1087032212

View in Genome Browser
Species Human (GRCh38)
Location 11:93717008-93717030
Sequence TCCCTATGTTGAAGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 2, 1: 22, 2: 39, 3: 36, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087032210_1087032212 8 Left 1087032210 11:93716977-93716999 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG 0: 2
1: 22
2: 39
3: 36
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087032212 Original CRISPR TCCCTATGTTGAAGGAGTGC TGG Intronic
900797158 1:4715071-4715093 TCCCCAGATGGAAGGAGTGCTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910775754 1:90872939-90872961 TCCCTAAGTGGTAGGAGTACAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915463639 1:156083247-156083269 TGCAGAGGTTGAAGGAGTGCAGG + Intronic
915568663 1:156731874-156731896 GCCCTATGTGGCAGCAGTGCTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
919330817 1:196168626-196168648 TCCCAAAGTAGAAGGTGTGCAGG + Intergenic
921935852 1:220796378-220796400 TCCCTACCTGGAAGGAATGCAGG - Intronic
1067078035 10:43199119-43199141 TCCCGATGTTGAAGCACTCCCGG + Exonic
1067735349 10:48846242-48846264 TCCATATTTTGTAGTAGTGCAGG + Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1073793250 10:106960964-106960986 TCCCTATCCAGAAGGAGTGAGGG - Intronic
1074541322 10:114367451-114367473 GCCCTATGTTGAAGTAGGGGAGG - Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077131661 11:976026-976048 CTTCTATGTTGAAGGACTGCTGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103744124 12:123110707-123110729 TTCCTAAGTAGAAGGGGTGCCGG - Intronic
1104174323 12:126315062-126315084 GCCCTAGCTGGAAGGAGTGCTGG - Intergenic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1106662487 13:31814504-31814526 TCCATATGTGGAAGGCGTTCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1111613498 13:90635968-90635990 TCCTTCTGTTGAAGGAGTCTAGG + Intergenic
1114895921 14:26991305-26991327 TTCCTTTCTGGAAGGAGTGCAGG + Intergenic
1115623974 14:35171291-35171313 TCCTTATGTTGCAGGCTTGCTGG + Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117377225 14:55128001-55128023 TCCCTAAGTTGAAAAACTGCAGG + Intronic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1117513321 14:56474252-56474274 GCCCTATGTTCAATGAGAGCTGG + Intergenic
1118027466 14:61784035-61784057 CCCCTATATTGAAGCAGTGGAGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125367733 15:38936885-38936907 TTTCTATGTTGAAGCAGTTCTGG + Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1132143201 15:99411317-99411339 ACCCTAAGTCGAAGGAGTACAGG + Intergenic
1134019310 16:10910487-10910509 TACCTCTGTTGAATGAGTGATGG - Intronic
1135589500 16:23695016-23695038 TACCTATGTGTAAAGAGTGCAGG + Exonic
1135881379 16:26260954-26260976 TCCCAATGTGCAAGGATTGCAGG - Intergenic
1139043460 16:63028980-63029002 TCCCTTAGTGGAAGGAATGCTGG - Intergenic
1143272046 17:5683073-5683095 TCTCTTTGTGGAAAGAGTGCTGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146740931 17:35282939-35282961 TCCCTCTGATGAAGGACTGAGGG - Intergenic
1150984261 17:70177545-70177567 TCCCTAAGGTGAAGGTGGGCTGG - Exonic
1151748952 17:76026200-76026222 TCCCAAAGTTGTAGGATTGCAGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153505425 18:5791646-5791668 TCCCTATGCACAAGGGGTGCTGG - Intergenic
1153834706 18:8953561-8953583 TACCTTTGTTGAAGGATTCCAGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1158401720 18:57127315-57127337 TCCATATGGTGGAGTAGTGCTGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164778017 19:30869491-30869513 CCCTTTTGTTGCAGGAGTGCAGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925125495 2:1452847-1452869 CCCCTAAGTTGAAGGGGTGTAGG - Intronic
926174274 2:10575095-10575117 TCCCTCTGTGACAGGAGTGCTGG - Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
929120600 2:38480976-38480998 TCCATATGTTGAAGGGGAGAAGG + Intergenic
930303003 2:49640520-49640542 TCCCTACTTTAAAGGAGGGCTGG + Intergenic
931464058 2:62471636-62471658 CACCTATCCTGAAGGAGTGCTGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933592461 2:84247917-84247939 TCCCTGTGTTGGAGAAGGGCTGG - Intergenic
935855173 2:107265924-107265946 ACCTTTTGTTGAAGGAGGGCAGG + Intergenic
937771213 2:125722488-125722510 TCCTTATGGGGAAGAAGTGCAGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
942593012 2:177566214-177566236 ACCCTATGGTGGAGGAATGCTGG - Intergenic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
946161623 2:217839285-217839307 ACCCTATGTTCAAGGAGCCCTGG + Intronic
946777222 2:223155772-223155794 TCCCTATTATTTAGGAGTGCTGG - Intronic
946820243 2:223621410-223621432 CCCCTATCTTAGAGGAGTGCTGG - Intergenic
947720810 2:232368199-232368221 TCCCTCTATTGCAGGGGTGCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1168941949 20:1720295-1720317 TACCTATGTTCAAGGGATGCAGG + Intergenic
1171065317 20:22009360-22009382 TCCCAAAGTTGTAGGAGTACAGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1183025484 22:35062963-35062985 TCCCAATGTTGGAGGATTGGAGG - Intergenic
1183562150 22:38583677-38583699 TCCATATGGTGAAGCAGGGCAGG + Intronic
1185135980 22:49072891-49072913 TCCTTATGGTGAAGCAGGGCAGG + Intergenic
954751867 3:52818373-52818395 TCTCGATGTTGAAGTAGTGAGGG - Exonic
958421108 3:93932814-93932836 ACCCTCTGTTCAAGGAGGGCAGG + Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
967228292 3:187314003-187314025 TCCCTATGAAGAAGGGGTGGAGG + Intergenic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
967678957 3:192337215-192337237 TCCCTATGTTACAGAAGTTCAGG + Intronic
968001114 3:195207355-195207377 ACCCTCTGTTGAAGAAGGGCAGG - Intronic
970917067 4:21348436-21348458 TCCCTATGCTGTAGGAGCACAGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
982189206 4:152836115-152836137 ACCATATGTTGAAGAGGTGCGGG + Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
991938967 5:71831764-71831786 TCTTTATGTTGAAGGAGATCAGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
999689563 5:154135002-154135024 TCCCTCTGTTGTATGAGTGAAGG + Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003713412 6:8619088-8619110 TCCCTCTGTTGCAGGTCTGCTGG + Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1009911975 6:69941393-69941415 TCCATATATTGAAGGAGAGGTGG + Intronic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1011799108 6:90991018-90991040 TCCCTATTCTGTAGGACTGCTGG - Intergenic
1012947403 6:105482327-105482349 TCTGTCTGGTGAAGGAGTGCTGG + Intergenic
1012971094 6:105731902-105731924 TTCCTCTGTTGAAGGATTCCAGG + Intergenic
1013212923 6:108002808-108002830 TCCCTATGGGGAAGGAGGGAGGG - Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019850702 7:3553828-3553850 TCCCTCAGTAGAAGGAGTGGTGG - Intronic
1020222968 7:6255601-6255623 TCCCTATCTTGATGAGGTGCTGG - Intronic
1021503203 7:21352420-21352442 TTCCTATTTAGAAGGATTGCAGG + Intergenic
1022363019 7:29681357-29681379 TTCTTATATTGAAGGAGTGTGGG - Intergenic
1022428295 7:30289242-30289264 TTCTTATATTGAAGGAGTGTGGG + Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1022698374 7:32732430-32732452 TTCTTATATTGAAGGAGTGTGGG + Intergenic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1024265225 7:47601229-47601251 TCCCTTTGCTGAAGGTCTGCAGG - Intergenic
1024325995 7:48109648-48109670 TCCCTTTGTTGAAGCTGTCCAGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024998410 7:55294174-55294196 TCCCTCTGCTGAAGGTCTGCTGG + Intergenic
1025192983 7:56910553-56910575 TATCTATGTTTTAGGAGTGCAGG + Intergenic
1025678962 7:63666367-63666389 TATCTATGTTTTAGGAGTGCAGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG + Intronic
1030978425 7:116156085-116156107 TCCTGATGCTGAAGGAGTCCTGG + Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032871495 7:135990905-135990927 TTTCCATGTTGATGGAGTGCAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040486954 8:47882686-47882708 TCACTCTGTTGCAGGAGTGGTGG - Intronic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043096196 8:75976930-75976952 TTCTTATGTTGAAGAAGTGAAGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1049694861 8:143978167-143978189 GCCCTCTGTTGGAGGAGTCCAGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055323362 9:75103640-75103662 TCCCTCTGTTGCTAGAGTGCTGG + Intronic
1055670449 9:78600280-78600302 TCCCTCTATTGAAGGGGTGGTGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186853601 X:13604381-13604403 TCCCTCTGGGGCAGGAGTGCTGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191725732 X:64278823-64278845 CCCCTCTGTTGCAGGTGTGCTGG + Intronic
1192216608 X:69163781-69163803 TCCCTCTGTTGCAGGATTACTGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194740448 X:97566590-97566612 TCCCTATGTGAAACGTGTGCAGG - Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201511646 Y:14770438-14770460 TCCCTCTGTTGCAGGTCTGCTGG - Intronic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic