ID: 1087039517

View in Genome Browser
Species Human (GRCh38)
Location 11:93784793-93784815
Sequence GCGGGTGCTGGGACCCAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087039517_1087039525 4 Left 1087039517 11:93784793-93784815 CCGGTCTGGGTCCCAGCACCCGC 0: 1
1: 0
2: 2
3: 29
4: 226
Right 1087039525 11:93784820-93784842 GCCTCCGCCTCTCCCGCGATGGG 0: 1
1: 0
2: 0
3: 10
4: 88
1087039517_1087039524 3 Left 1087039517 11:93784793-93784815 CCGGTCTGGGTCCCAGCACCCGC 0: 1
1: 0
2: 2
3: 29
4: 226
Right 1087039524 11:93784819-93784841 GGCCTCCGCCTCTCCCGCGATGG 0: 1
1: 0
2: 1
3: 16
4: 103
1087039517_1087039527 5 Left 1087039517 11:93784793-93784815 CCGGTCTGGGTCCCAGCACCCGC 0: 1
1: 0
2: 2
3: 29
4: 226
Right 1087039527 11:93784821-93784843 CCTCCGCCTCTCCCGCGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1087039517_1087039528 6 Left 1087039517 11:93784793-93784815 CCGGTCTGGGTCCCAGCACCCGC 0: 1
1: 0
2: 2
3: 29
4: 226
Right 1087039528 11:93784822-93784844 CTCCGCCTCTCCCGCGATGGGGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087039517 Original CRISPR GCGGGTGCTGGGACCCAGAC CGG (reversed) Intronic
900095700 1:939291-939313 GCGGGAGCTGGGGCCCAGCATGG + Exonic
900144012 1:1150266-1150288 GCAGGTGCTGGGACCCACCTGGG - Intergenic
900181143 1:1311498-1311520 CAGGGTGCTGGGACCCGGGCAGG - Exonic
900359832 1:2283158-2283180 GCGGAGGCTGGGTCCCAGGCTGG + Intronic
900809526 1:4791026-4791048 GCAGGTGCTGGAGCCCAGAGAGG + Exonic
901199106 1:7456768-7456790 GCAGGTGCTGGGACACAGCAGGG + Intronic
901932368 1:12603641-12603663 GGGGGAGGTGGGACGCAGACAGG + Intronic
902089687 1:13893246-13893268 GCTGGTGCTGGAACACAGCCGGG + Intergenic
902404170 1:16174038-16174060 GCTGATGCTGAGCCCCAGACGGG - Intergenic
903920847 1:26799612-26799634 GAGGGTGCTGGGGCTCAGCCAGG - Intergenic
904079420 1:27862710-27862732 GTGGGTGCTGGGTTCCAGAGGGG - Intergenic
904385743 1:30140853-30140875 GCTGGAGCTGGAAGCCAGACGGG + Intergenic
904826075 1:33274607-33274629 GAGGGTGCTCTGACCCAAACTGG + Intronic
905658642 1:39702784-39702806 ACAGGTGCTGGGGGCCAGACAGG + Intronic
906676080 1:47694477-47694499 GCAGGGGCTGGGGCCCAGGCAGG + Intergenic
906805560 1:48776547-48776569 GCGGGGGCTGGGACCCCGGGAGG - Intronic
907155088 1:52326475-52326497 GAGGGTCCTGGGACACAGAGAGG + Intronic
907447500 1:54518180-54518202 GCGGAGACTGTGACCCAGACCGG - Intergenic
909629894 1:77759944-77759966 CCAGGTGCGGGGACCCAGGCCGG + Intergenic
912747899 1:112260663-112260685 ATGAGTGCTGGGACCCGGACTGG + Intergenic
915281625 1:154826553-154826575 TGGGGTGCTGGGACACAGGCGGG - Intronic
921944077 1:220874518-220874540 GCGGGTGCTGGTAGGCAGATTGG + Intergenic
922617285 1:226968677-226968699 GCTGCTGCAGGGACCCAGACGGG + Intronic
922881415 1:228983934-228983956 GCTAGTGCTGGGACCCAGTAGGG + Intergenic
1065352044 10:24804334-24804356 GCAGGGGCTGGGACCCACACAGG + Intergenic
1069658870 10:70110255-70110277 GCTGGTGCTGTGGCCCAGCCTGG + Intronic
1070759075 10:79012172-79012194 GAGGGTTTTAGGACCCAGACTGG + Intergenic
1071525191 10:86354287-86354309 GGGGTTGCTAGCACCCAGACAGG + Intronic
1074693169 10:116025382-116025404 GCAGGTGGTGGGAACCAGCCAGG + Intergenic
1075483414 10:122800469-122800491 GCTGCTGCTGGGACCCAGGTGGG - Intergenic
1075815827 10:125264231-125264253 GCAGCTGCTGGGACGCAGGCTGG + Intergenic
1075930078 10:126288347-126288369 GAGGGTGCTGGGACCCAGCCTGG - Intronic
1076513157 10:131026416-131026438 GGGAGTGCTGGGACACAGCCAGG + Intergenic
1078492636 11:11783617-11783639 GGGGGTGCTGGCACCAAGGCTGG - Intergenic
1080309359 11:30871322-30871344 GTGGCCACTGGGACCCAGACAGG + Intronic
1081658561 11:44873991-44874013 GCGGGTGCTGGGTCCAAGGTGGG - Intronic
1081661813 11:44893041-44893063 GCGGGAGCTGAGGCCCAGAGAGG - Intronic
1081668830 11:44932145-44932167 GCGGGTGCTGGGGCCTCGGCTGG - Exonic
1081850429 11:46271841-46271863 GCAGGGGCTGAGACCCAGAAGGG - Intergenic
1083643477 11:64158349-64158371 GAGGCTGCTGGGACCCATTCTGG + Intronic
1084055253 11:66627785-66627807 GCTGGGGCTGGGACCCAGAAAGG + Intronic
1084263614 11:67993883-67993905 TCCGGGGCTGGGACCCATACAGG - Intronic
1084640809 11:70424579-70424601 GTGGGTGATGGGACCCAGTAAGG + Intronic
1084650904 11:70488657-70488679 GCTGCCGCTGGGACCCAGAAGGG - Intronic
1085206368 11:74734919-74734941 AGGGGTCCCGGGACCCAGACTGG - Intergenic
1085508919 11:77075497-77075519 GCTAGTGCTCGGACCCAGCCTGG + Intronic
1085702519 11:78757540-78757562 GTGGGAGCTGGGAGCCAGACAGG + Intronic
1086428921 11:86716589-86716611 GAGGGTGGAGGGACCCAGAAAGG + Intergenic
1087039517 11:93784793-93784815 GCGGGTGCTGGGACCCAGACCGG - Intronic
1090653325 11:128824874-128824896 GAGGGTGCTGGGAGCCACAGGGG + Intergenic
1092059513 12:5536985-5537007 GAGGGAGCTGGGATCCAGATCGG + Intronic
1096714383 12:53482609-53482631 TCAAGTGCTGGGACCCAGCCCGG + Exonic
1100089623 12:90954344-90954366 GCGGGTCCTGGAACCCTGGCTGG - Exonic
1101982726 12:109421675-109421697 GAGGAAGCTGAGACCCAGACAGG + Intronic
1102029119 12:109729968-109729990 GCTGGGGCTTGAACCCAGACAGG + Intronic
1102533059 12:113561219-113561241 GGGGATGCTGGGACGCACACAGG - Intergenic
1102677050 12:114666012-114666034 GCGGGGTCTGGAACCAAGACTGG - Intergenic
1102763511 12:115410404-115410426 GGGGGTTTTGGGACTCAGACTGG + Intergenic
1103698524 12:122835577-122835599 GCGGGTGCTGAGCCGCAGGCCGG + Exonic
1103735834 12:123060340-123060362 CCAGGTGATGGCACCCAGACGGG - Intronic
1103763373 12:123266477-123266499 ACTGGTGCTGGGGCCCAGCCAGG + Intronic
1104585424 12:130044672-130044694 GCGGGTGCTGGGAACCACGAGGG + Intergenic
1104982008 12:132577354-132577376 GCGGGGGCTGGGAGACAGAAAGG - Intronic
1105043998 12:132986621-132986643 GCGACTCCTGGTACCCAGACCGG + Exonic
1110948135 13:81450282-81450304 GAGGTTTCTGGGACTCAGACTGG + Intergenic
1111103333 13:83613905-83613927 GCAGGTGCTGGGAGCCAGCGAGG + Intergenic
1112440655 13:99422384-99422406 GAGGATGCTGAGACCCAGAGAGG + Intergenic
1114470413 14:22957232-22957254 TCGGGTGGTGGAACCCGGACTGG + Intronic
1114639036 14:24206726-24206748 GAGGGCGCTGCCACCCAGACTGG + Intronic
1117954023 14:61109013-61109035 GAGTGTGCTGGGACACAGATAGG - Intergenic
1121539146 14:94711955-94711977 GCGGGTGCTCAGACCCTCACTGG + Intergenic
1122767891 14:104084469-104084491 GCGGGTGCAGGGTCCCAGGAGGG - Intergenic
1122816483 14:104316564-104316586 GCGTGTGCAGGGGCCCAGCCTGG + Intergenic
1122970036 14:105148725-105148747 GCGGGTGCTGGAACACTCACTGG + Exonic
1123017622 14:105382951-105382973 GGGGGTGCAGGGACCCCGAGGGG - Intronic
1123056064 14:105571425-105571447 GCGGGTGCTGGGCCAGAGTCGGG + Intergenic
1123057319 14:105577518-105577540 GCGGGTGCTGGGCCAGAGCCGGG - Intergenic
1123057863 14:105580371-105580393 GCGGGTGCTGGGCCAGAGTCGGG - Intergenic
1123080495 14:105691556-105691578 GCGGGTGCTGGGCCAGAGTCGGG + Intergenic
1132675699 16:1120467-1120489 TCCGGTGCTGGGGCCCAGAGGGG + Intergenic
1132713161 16:1278199-1278221 GCGGGTGCTGGGACCCCAGCCGG + Intergenic
1132767028 16:1539549-1539571 GCGGGGGCTGAGAGCCAGCCTGG - Intronic
1132880239 16:2158928-2158950 GAGGCTGCTGGGATCCAGAGTGG - Intronic
1132958068 16:2606898-2606920 GCGGGTGGTGGGTCCCAAGCTGG - Intergenic
1132970542 16:2686146-2686168 GCGGGTGGTGGGTCCCAAGCTGG - Intronic
1133098733 16:3466138-3466160 GCCGGTGCTGGCACCCAGAGTGG - Intronic
1135985332 16:27179679-27179701 GCGGCAGCTGGGACCCAGTTAGG + Intergenic
1136537750 16:30910416-30910438 GCGGGTGGGAGGACCCAGAAGGG + Intergenic
1137686527 16:50390634-50390656 TCCGGAGCTGGGACCCAGGCAGG + Intergenic
1137720813 16:50626389-50626411 ACAGGTGCTGGGACAGAGACTGG + Intronic
1140893152 16:79302136-79302158 GCGAGGGCTGGGATCCAGCCTGG + Intergenic
1141096492 16:81166485-81166507 GCTGGTGCGGGGACCCAGGAAGG + Intergenic
1141422678 16:83926794-83926816 GCGCTTGCGAGGACCCAGACTGG - Exonic
1141600679 16:85124301-85124323 GCGGGGACTGGGCCCCAGCCAGG + Intergenic
1141659092 16:85432009-85432031 GCGAGTGCTGGGACGCACACCGG + Intergenic
1143011251 17:3867377-3867399 GCGGGTGGTGGGGCACAGGCTGG + Intronic
1143597316 17:7923073-7923095 GCGGGCGCAGGGACCCAACCCGG - Exonic
1143649783 17:8256404-8256426 GCAGGTGCTGTGCCCTAGACTGG + Exonic
1143780922 17:9229328-9229350 CCCGCTGCTGGGACCCGGACTGG + Intronic
1144687671 17:17236963-17236985 GGCGGGGCTGGGACCCAGAGCGG - Exonic
1145249991 17:21292027-21292049 GCAGGAGCTGGGACCCAGGCTGG + Intronic
1145272910 17:21414102-21414124 GAGGGTGGTGGGACCCAGCTTGG + Intronic
1145311113 17:21701538-21701560 GAGGGTGGTGGGACCCAGCTTGG + Intronic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1147609992 17:41796246-41796268 GCGCCAGCTGGGACCCAGGCAGG + Intergenic
1147752237 17:42743497-42743519 TCAGGTGCTGTCACCCAGACTGG + Intronic
1148084829 17:44987815-44987837 GCGGCGGCGGAGACCCAGACAGG - Intergenic
1148695688 17:49556724-49556746 CCGGGTGCTGGGCCCGGGACTGG + Intergenic
1150226666 17:63528202-63528224 GTGGACGCTGGGACCTAGACAGG - Intronic
1151969525 17:77450637-77450659 GGATGTGCTGGGACCCAGAGGGG - Intronic
1152111242 17:78358816-78358838 GCAGGTTCTTGGTCCCAGACTGG + Exonic
1152698090 17:81806205-81806227 GCGGGTGGTGGGTCCCATATGGG - Intronic
1152699582 17:81812352-81812374 GAGGGAGCCGGCACCCAGACAGG + Intronic
1154213261 18:12397571-12397593 GCGGCTGCTGGGGCCCACACTGG - Intergenic
1157621765 18:49021058-49021080 GCGGGATCCGGGACCCACACTGG - Intergenic
1157747764 18:50151396-50151418 GAGGGTGCTGAGACCCAGAATGG - Intronic
1160389144 18:78517462-78517484 GCGGTTCCTGGGAACCAGGCAGG + Intergenic
1160455518 18:78996313-78996335 GAGGCTGCCGGAACCCAGACAGG - Intronic
1160675880 19:390967-390989 GCGTGGGCTGGGAGCCAGCCAGG - Intergenic
1160754932 19:752126-752148 GAGGGAGCTGGGACCCAGAGAGG - Intronic
1160843082 19:1155089-1155111 GCGAGTGCAGGGACCCAGGCTGG + Intronic
1160994423 19:1876080-1876102 GCGGCCGCTGGGACCCAGCCAGG - Intergenic
1161394280 19:4037171-4037193 GCAGGTGCTGAGCCCCAGGCAGG - Intronic
1162514114 19:11138087-11138109 GAGGGTGCTGAGACTGAGACGGG + Intronic
1162525736 19:11205090-11205112 GCGGGTGCTGGCATCAAGCCTGG + Intronic
1162535951 19:11262758-11262780 GGAGGCGCTGGGACCCAGACTGG + Intergenic
1162536029 19:11262987-11263009 GGAGGCGCTGGGACCCAGGCTGG + Intergenic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1163243190 19:16076707-16076729 GCGGGTGCGGGGCCCGAGGCCGG - Intronic
1163425148 19:17236728-17236750 GCCTCTGCAGGGACCCAGACCGG - Intronic
1163575930 19:18110678-18110700 GGGGCTGCTGGGACCCAGCAGGG - Intronic
1163600833 19:18248185-18248207 GCAGGTCATGGGACCCAGGCAGG - Intronic
1163666765 19:18607064-18607086 GGGGGTGCCGGGTCCCAGACTGG - Intronic
1164797697 19:31047434-31047456 GAAGGTGCTGAGACCCAGAGAGG - Intergenic
1165089750 19:33378337-33378359 GCGGGTCCTGGGACCCAGGCTGG - Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165333604 19:35154693-35154715 GAGCGGGCGGGGACCCAGACGGG - Intergenic
1165832822 19:38737556-38737578 GGAGGTGCTGGGCCCCAGCCCGG - Exonic
1165902849 19:39176786-39176808 GCGGGAGATGGGGCCCAGTCTGG + Intronic
1165922746 19:39308756-39308778 GTGGGTGATGGGACACAGCCAGG - Intronic
1165958311 19:39515567-39515589 GCTGGGGCTGGGACCCGGACTGG - Exonic
1166714051 19:44955369-44955391 GCGGGGGCGGGGACCCGGAGCGG + Exonic
1167377207 19:49118651-49118673 GCGGAGGCAGGGACCCAGTCTGG + Exonic
1167591253 19:50405744-50405766 CAGGGTGCTGGGGCCCAGCCTGG - Intronic
925267279 2:2574887-2574909 GTGGGTGCAGGGATGCAGACAGG - Intergenic
927708363 2:25310827-25310849 TCGGGGGATGGGACCCAGCCGGG - Intronic
931439101 2:62274972-62274994 GAGGGGGCTGGGACCAAGAGGGG - Intergenic
933840699 2:86283843-86283865 GCAGGTGCTGGAGCCCAGCCAGG + Intronic
936090655 2:109499496-109499518 GGGGGTGCAGGGGCCCAGCCAGG + Intronic
937080593 2:119137002-119137024 CCAGGTGCTGTGAGCCAGACAGG + Intergenic
937908702 2:127065015-127065037 GCCGGGGCTGGGGCCCAGGCTGG + Intronic
937912254 2:127081417-127081439 GGGGCTGCTGGGGCCCAGCCGGG - Intronic
938249892 2:129806475-129806497 GAGGGGCCTGGGACTCAGACCGG + Intergenic
938259224 2:129883317-129883339 TCGGGTGCAGGGAGCCAGGCAGG - Intergenic
938782814 2:134600844-134600866 GAGGGAGCTGGGGCCCAGAGAGG - Intronic
947827687 2:233117555-233117577 GCAGGTGCTGGAACCCAGAGGGG - Intronic
947876258 2:233470079-233470101 GCGGGTGCTGTTTCCCAGGCGGG + Exonic
948692601 2:239715989-239716011 GCTGGTGCTGGGGACCAGGCAGG + Intergenic
948874094 2:240818268-240818290 GAGGGTGCTGGGTCCAAGGCAGG - Intronic
948940240 2:241191684-241191706 GTGGGTGCTGGGAGCCCGGCTGG - Intronic
1168771495 20:419526-419548 GAGGGTGCTGTGAGCCCGACTGG - Intronic
1168773921 20:433044-433066 GCTGGGGCTGAGACCCAGCCTGG - Intergenic
1169367283 20:5001564-5001586 GAGGGAGGTGGGCCCCAGACCGG - Intronic
1172481612 20:35274958-35274980 GAGGGTGCTGGGTTCCAGCCAGG - Exonic
1172614379 20:36273965-36273987 GCTGGTGCTGGGACTCACAGCGG + Intergenic
1173666313 20:44765832-44765854 GTGGGTGCTGGGAGCCAGCCTGG + Intronic
1175804409 20:61819526-61819548 GCGGGTGCTGGGCTGCAGCCCGG - Intronic
1176038262 20:63050678-63050700 GTGGCTGCTGGGACCCCCACAGG + Intergenic
1176111879 20:63414580-63414602 GCGGGTGCTGGGGCTGAGGCGGG + Intronic
1176191218 20:63811079-63811101 TGGGGTTCTGGGACCCAGAGAGG - Intronic
1178392969 21:32214384-32214406 GCGAGAGCTGGGATGCAGACGGG + Intergenic
1178960253 21:37058581-37058603 GCGGGTGCTGAGACTGGGACAGG + Intergenic
1179074965 21:38112616-38112638 GCTAGTGCTGGGACCCAGTGTGG + Intronic
1179978935 21:44886553-44886575 GCCGGTGCTGGGACCCTGGGGGG - Intronic
1180054303 21:45349224-45349246 GGGGCTGTGGGGACCCAGACAGG - Intergenic
1180998062 22:19975314-19975336 GAGGGGGCTGGGAGCCAGGCGGG - Intronic
1181774235 22:25148186-25148208 GGGGGTGCTGGGACTGAGAAAGG - Intronic
1183364709 22:37400691-37400713 CCGGGTGCTGGGACCCTGGCGGG - Intronic
1183856088 22:40636261-40636283 GCCGGGGCTGGGACCCGGGCCGG - Intronic
1184298972 22:43543748-43543770 GCTGGTGCTGGGCTCCTGACGGG - Intronic
1184409513 22:44318441-44318463 GCGGGTGCTGGGCCCAGGCCTGG + Intergenic
1184768952 22:46586956-46586978 GTGGGTTCTGGGACACAGACGGG - Intronic
1185272169 22:49934691-49934713 GGCGGTGCTGGGGCCCAGAAAGG + Intergenic
1185340195 22:50287624-50287646 GGGGGTCCTGGGCCCCAGGCCGG - Intronic
950471665 3:13190146-13190168 GAGGGTTCTTGGACCCAGACAGG - Intergenic
957079054 3:75621834-75621856 TCCGGGGCTGGGACCCATACAGG - Intergenic
960710436 3:120522216-120522238 GCTGGTGCTGGAACCCAAACTGG - Intergenic
961506095 3:127371447-127371469 GGGGGTACTGGGAGCCAGGCGGG - Intergenic
962222359 3:133574198-133574220 GCGGGCGCGGGGACCCGGCCGGG + Exonic
962629594 3:137262943-137262965 GAGGTTGGTGGGAACCAGACTGG - Intergenic
965765426 3:172125326-172125348 GCCGCTGCTGTGACCCGGACTGG - Intronic
967888218 3:194347345-194347367 GAGGGTGATGGGACCTAGAATGG + Intronic
968649451 4:1754683-1754705 GCAGGTGCTGGGTCCGGGACAGG - Intergenic
969429393 4:7145361-7145383 ATGGGTGCTGGGACACAGGCAGG - Intergenic
969685580 4:8672250-8672272 GCGAATGCTGAGACCCAGCCTGG - Intergenic
971294562 4:25377144-25377166 GGGGGTGCTGAGAGCCAGAAGGG - Intergenic
971934176 4:33126164-33126186 GAGAGTGCTGAGACCAAGACAGG - Intergenic
980126090 4:128775738-128775760 GCAGGTGCTGGGACCAAGAATGG - Intergenic
985547778 5:518738-518760 GCTGGAGCTTGGGCCCAGACAGG + Intronic
985602313 5:841608-841630 GCGGGTCCAGGGACACAGAGTGG - Intronic
985695672 5:1338804-1338826 GAGGGTGCTGGGACCCTGGCTGG - Intronic
985896158 5:2751112-2751134 CTGGGCGCCGGGACCCAGACGGG - Intronic
985966230 5:3340608-3340630 GGAGGTGCTGGGCCCCAGCCTGG + Intergenic
987123781 5:14792387-14792409 GCTTGGTCTGGGACCCAGACTGG + Intronic
997554585 5:134784306-134784328 GAGATTGCTGGGCCCCAGACAGG - Intronic
997569695 5:134916931-134916953 AGGAGTGCTTGGACCCAGACAGG + Intronic
999244572 5:150147159-150147181 GGGGGTGCTGGGGCCCCCACAGG - Intronic
1001381959 5:171311251-171311273 GCGCGGGCTGGGAGGCAGACGGG + Intronic
1003901661 6:10660272-10660294 GCGGGCGCAGGGAGCGAGACTGG + Intergenic
1004915210 6:20325710-20325732 CCGGGTGCAGGGACTCACACCGG + Intergenic
1006379108 6:33687565-33687587 GTGGGTGCTGGCCCCGAGACTGG + Intronic
1006404697 6:33838153-33838175 GAGGGGGCTGTGACACAGACAGG + Intergenic
1006906449 6:37536623-37536645 GCGCGCGCAGGGACCCACACAGG + Intergenic
1007387351 6:41528802-41528824 CTGGGTCCTGGGAGCCAGACGGG + Intergenic
1019472164 7:1226932-1226954 CCTGGTGCTGGGGCCCAGCCTGG + Intergenic
1020890974 7:13877251-13877273 GAGAGTTTTGGGACCCAGACTGG + Intergenic
1023594694 7:41816477-41816499 GGGGTTGCTGAGACCCAGATAGG - Intergenic
1024611299 7:51066464-51066486 GCAGGTGCTTGGGACCAGACTGG + Intronic
1026625447 7:71987940-71987962 GCGGGTCCAGGGACACAGACTGG + Intronic
1026832522 7:73618802-73618824 GAGGTTGCTGGGATACAGACAGG - Intronic
1026972196 7:74475375-74475397 GAGGGTACTGGGGCCCAGAGAGG + Intronic
1028121443 7:87059786-87059808 GCGGGGGCTGCGGCCCAGCCCGG + Intergenic
1029467378 7:100734715-100734737 GCGGGTTCTGGGAGCGGGACAGG + Intronic
1032192849 7:129774382-129774404 GCGTGTGCTGGGAGCCTGGCTGG + Intergenic
1034972700 7:155428926-155428948 GCAGGTGGGGGGACCCAGAGAGG + Intergenic
1036953915 8:13166822-13166844 GCAGGTGCTGGGACCTAGGTGGG + Intronic
1037893370 8:22635986-22636008 GCAGGTGCTGGGAAACAGCCAGG - Intronic
1040436620 8:47397754-47397776 GTGGGAACTGGGACCCAGGCAGG + Intronic
1045971539 8:108083846-108083868 CCGGGTTCTGGGACCCAGCAAGG - Intergenic
1046547425 8:115669092-115669114 GCGGGTGCTCGGAGCCGGGCGGG - Intronic
1046851835 8:118983419-118983441 GTGGTTGCTGGGAAGCAGACTGG - Intergenic
1048443209 8:134475274-134475296 GCAGGAGCTGGGGCCCAGCCTGG - Intergenic
1049197980 8:141325833-141325855 GCGGGGGCAAGGACCCAGAGAGG + Intergenic
1049418769 8:142507575-142507597 CCGGGTGCTGGCTCCCAGGCTGG + Intronic
1051038328 9:12776048-12776070 GCGGGGGCTGGGACCTGGGCTGG + Intronic
1052991264 9:34520590-34520612 GGTGGTGCTGGGACCCAGAGAGG + Intronic
1057442375 9:95091578-95091600 GCGGGTGCTGGGAACGACCCTGG - Intergenic
1057596452 9:96418883-96418905 GCGGGTGGTGGGACCGAGGGCGG - Intergenic
1058596446 9:106621011-106621033 GTGTGTGCTGGGAGGCAGACAGG - Intergenic
1058970844 9:110081619-110081641 GCGGGTGCTGGGGCCTCGACTGG - Intronic
1059340268 9:113594090-113594112 GCCGGGGCTGGGACTCAGACAGG - Intronic
1060480109 9:124012634-124012656 CCGGCTGCTGGGACGCAGAAGGG + Intronic
1060527225 9:124327456-124327478 GGGGCTGCTGGGGCACAGACAGG - Intronic
1061238761 9:129357297-129357319 GAGGATGCTGAGACCCAGAGAGG - Intergenic
1061919125 9:133772484-133772506 GCCGGTGCCGAGGCCCAGACAGG - Intronic
1062414259 9:136439817-136439839 GCGGTTGCTGGGTCCCGGCCGGG - Exonic
1062598484 9:137309713-137309735 GGGGGTGCTGAGGCCCAGGCGGG + Intronic
1186561808 X:10620647-10620669 GTGGGTCCTGGGAGCCAGAAAGG + Intronic
1190157659 X:48006800-48006822 GCGGGTACTGGGAGGCAGAATGG + Intronic
1190173431 X:48129685-48129707 GCGGGTACTGGGAGGCAGAATGG + Intergenic
1190325494 X:49204769-49204791 AGGGGTGCTTGGACCCAGAGAGG - Intergenic
1190332877 X:49246851-49246873 TGGGGTGCTGGGGCCAAGACTGG + Exonic
1190644216 X:52509912-52509934 TTAGGTGCTGGAACCCAGACAGG - Intergenic
1195094927 X:101493348-101493370 CCTGGTGCTGGGGACCAGACTGG + Exonic
1198989103 X:142490480-142490502 GCAGGTGCTGAGACACAGTCTGG + Intergenic
1199847335 X:151700805-151700827 GGTGGTGCTGGGGCCCAGTCGGG + Exonic
1201901046 Y:19046543-19046565 GCGGGCGCAGGGCTCCAGACTGG - Intergenic