ID: 1087048157

View in Genome Browser
Species Human (GRCh38)
Location 11:93861771-93861793
Sequence GTGTTTGTTGGCGTGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087048157_1087048163 19 Left 1087048157 11:93861771-93861793 CCAGAGAACACGCCAACAAACAC No data
Right 1087048163 11:93861813-93861835 TGCTGTTTTAATGAGCACCCGGG No data
1087048157_1087048164 29 Left 1087048157 11:93861771-93861793 CCAGAGAACACGCCAACAAACAC No data
Right 1087048164 11:93861823-93861845 ATGAGCACCCGGGTGCAGACAGG No data
1087048157_1087048162 18 Left 1087048157 11:93861771-93861793 CCAGAGAACACGCCAACAAACAC No data
Right 1087048162 11:93861812-93861834 ATGCTGTTTTAATGAGCACCCGG 0: 12
1: 43
2: 33
3: 47
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087048157 Original CRISPR GTGTTTGTTGGCGTGTTCTC TGG (reversed) Intergenic
No off target data available for this crispr