ID: 1087048262

View in Genome Browser
Species Human (GRCh38)
Location 11:93862565-93862587
Sequence ACTTATTAGCAGAAGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087048262_1087048266 21 Left 1087048262 11:93862565-93862587 CCCACCCTCTTCTGCTAATAAGT No data
Right 1087048266 11:93862609-93862631 GATAAATTGCCACATGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087048262 Original CRISPR ACTTATTAGCAGAAGAGGGT GGG (reversed) Intergenic
No off target data available for this crispr