ID: 1087048266

View in Genome Browser
Species Human (GRCh38)
Location 11:93862609-93862631
Sequence GATAAATTGCCACATGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087048265_1087048266 16 Left 1087048265 11:93862570-93862592 CCTCTTCTGCTAATAAGTAGTCT No data
Right 1087048266 11:93862609-93862631 GATAAATTGCCACATGCATTTGG No data
1087048260_1087048266 29 Left 1087048260 11:93862557-93862579 CCACAGACCCCACCCTCTTCTGC No data
Right 1087048266 11:93862609-93862631 GATAAATTGCCACATGCATTTGG No data
1087048263_1087048266 20 Left 1087048263 11:93862566-93862588 CCACCCTCTTCTGCTAATAAGTA No data
Right 1087048266 11:93862609-93862631 GATAAATTGCCACATGCATTTGG No data
1087048262_1087048266 21 Left 1087048262 11:93862565-93862587 CCCACCCTCTTCTGCTAATAAGT No data
Right 1087048266 11:93862609-93862631 GATAAATTGCCACATGCATTTGG No data
1087048261_1087048266 22 Left 1087048261 11:93862564-93862586 CCCCACCCTCTTCTGCTAATAAG No data
Right 1087048266 11:93862609-93862631 GATAAATTGCCACATGCATTTGG No data
1087048264_1087048266 17 Left 1087048264 11:93862569-93862591 CCCTCTTCTGCTAATAAGTAGTC 0: 15
1: 8
2: 2
3: 36
4: 449
Right 1087048266 11:93862609-93862631 GATAAATTGCCACATGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087048266 Original CRISPR GATAAATTGCCACATGCATT TGG Intergenic
No off target data available for this crispr