ID: 1087056846

View in Genome Browser
Species Human (GRCh38)
Location 11:93945167-93945189
Sequence ACTGAGATCCAGACTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087056845_1087056846 -5 Left 1087056845 11:93945149-93945171 CCAGGGTCTGAGTCAGGGACTGA No data
Right 1087056846 11:93945167-93945189 ACTGAGATCCAGACTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087056846 Original CRISPR ACTGAGATCCAGACTGTGCC AGG Intergenic
No off target data available for this crispr