ID: 1087058463

View in Genome Browser
Species Human (GRCh38)
Location 11:93956058-93956080
Sequence CAGATTAAGTAGTTAGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087058463_1087058468 8 Left 1087058463 11:93956058-93956080 CCATAATCTAACTACTTAATCTG No data
Right 1087058468 11:93956089-93956111 TCATTTCCACACCCATAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087058463 Original CRISPR CAGATTAAGTAGTTAGATTA TGG (reversed) Intergenic
No off target data available for this crispr