ID: 1087063170

View in Genome Browser
Species Human (GRCh38)
Location 11:94002638-94002660
Sequence CTTTAATGGTAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087063167_1087063170 16 Left 1087063167 11:94002599-94002621 CCATGCTGAAAGCTCTAGGCTTA No data
Right 1087063170 11:94002638-94002660 CTTTAATGGTAGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087063170 Original CRISPR CTTTAATGGTAGAAGGAAGA AGG Intergenic
No off target data available for this crispr