ID: 1087071174

View in Genome Browser
Species Human (GRCh38)
Location 11:94082372-94082394
Sequence ACATAAAAGGTACAGCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087071174_1087071177 5 Left 1087071174 11:94082372-94082394 CCTCCAAGCTGTACCTTTTATGT 0: 1
1: 1
2: 2
3: 14
4: 188
Right 1087071177 11:94082400-94082422 TTTCTTTCTTCTCTGTAGAAAGG 0: 1
1: 0
2: 13
3: 112
4: 1080
1087071174_1087071178 16 Left 1087071174 11:94082372-94082394 CCTCCAAGCTGTACCTTTTATGT 0: 1
1: 1
2: 2
3: 14
4: 188
Right 1087071178 11:94082411-94082433 TCTGTAGAAAGGAATAGACAAGG 0: 1
1: 0
2: 23
3: 921
4: 888

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087071174 Original CRISPR ACATAAAAGGTACAGCTTGG AGG (reversed) Intronic
901865320 1:12102821-12102843 ACATAAAAAGTACAGCTAGGCGG - Intronic
902035947 1:13458187-13458209 AAATAAAAGGTTGGGCTTGGTGG + Intergenic
902969387 1:20035672-20035694 ACTTAAAAGATACAGAATGGTGG - Intronic
910467578 1:87516563-87516585 ACACAAACTGTACAGCCTGGAGG - Intergenic
910762246 1:90745208-90745230 ACACAAAAGGGAGAGGTTGGAGG - Intergenic
911205729 1:95090130-95090152 ACTTCAAAGGGACAGCTTGATGG - Intergenic
913058800 1:115185938-115185960 ACATAAAATGCAAAGCTTGGGGG + Intergenic
915842381 1:159224880-159224902 CCATAAGAGGTAAAGGTTGGTGG + Intergenic
916934310 1:169611871-169611893 ACATTAAGAATACAGCTTGGAGG - Intronic
919937577 1:202264775-202264797 AAATACAAGGAATAGCTTGGAGG + Intronic
921483195 1:215687254-215687276 ACTTAAAATGTTCAGCTTGGAGG + Intronic
921904037 1:220477498-220477520 ATATAAAAGGGTCAGATTGGTGG - Intergenic
924302239 1:242651683-242651705 ACATCAAGGGAACAGCTTGTGGG - Intergenic
1063629652 10:7721931-7721953 ACATAAAAGATAATGCTTAGCGG - Intronic
1063947176 10:11189396-11189418 AATTAAAAGGTAGAGCTTGTCGG - Intronic
1067353571 10:45501698-45501720 AGATAAAAGCTATAGCCTGGGGG + Intronic
1068157228 10:53215868-53215890 ACTTAAAAGATACAGAATGGTGG - Intergenic
1070644816 10:78194685-78194707 ACAGGAGAGGGACAGCTTGGCGG + Intergenic
1070678134 10:78428964-78428986 TCATAAAAGGCACACCTTGGTGG - Intergenic
1070679451 10:78438391-78438413 ACAGAAAAGTTACAGCATGCCGG + Intergenic
1071247019 10:83776143-83776165 ACTTAAAAGATATAGATTGGAGG + Intergenic
1071595427 10:86919187-86919209 ACATTAAAGGTACAGGTTCCTGG + Exonic
1072283594 10:93892776-93892798 AAAAAAAAGGTCCAGTTTGGAGG + Intergenic
1072821877 10:98566470-98566492 ACATAAAAGGTGTAGCTTGAAGG - Intronic
1075877476 10:125820029-125820051 ACATAGAAGGTACGGGTTTGAGG - Intronic
1076056667 10:127380241-127380263 ACGTATAAGGTAGAGTTTGGTGG + Intronic
1078296909 11:10080651-10080673 ACTTAAAAGATACAGATTCGTGG + Intronic
1079818120 11:25088862-25088884 AAATATAAGGTACAGCAAGGAGG - Intergenic
1081001696 11:37681049-37681071 ACATCAGAGGGACAGCTTGATGG + Intergenic
1081050488 11:38333949-38333971 ACATAAAAGCTAAAGCTATGTGG - Intergenic
1081566406 11:44263780-44263802 ACACATAAGCTAGAGCTTGGGGG - Exonic
1083102691 11:60326521-60326543 ACATGAGAGGGACAGCTTGATGG - Intergenic
1087071174 11:94082372-94082394 ACATAAAAGGTACAGCTTGGAGG - Intronic
1088885692 11:114004674-114004696 ACATAGAAAGTACAGCTTGTAGG - Intergenic
1089834968 11:121362543-121362565 ACATTAAAGGTACAGGTTCCTGG - Intergenic
1093023465 12:14223561-14223583 ACTTAAAAGTTAAAGCTTTGAGG + Intergenic
1093069477 12:14693618-14693640 ACACAAAAGGTACAGGTTTTTGG - Intronic
1098928752 12:76384316-76384338 ACATAAAAGGCAGATATTGGTGG + Exonic
1099425488 12:82518379-82518401 ACTTCAAAGGCACAGCTTGATGG - Intergenic
1100138164 12:91581899-91581921 AATTAAAAGGTACAGCTTTTTGG - Intergenic
1102532847 12:113559439-113559461 ACATAGAAGGCATAGCTTAGTGG - Intergenic
1105321401 13:19325634-19325656 ACTTAAAAGATATAGATTGGTGG + Intergenic
1106485896 13:30172144-30172166 ATTTGAAAGGTACAGCTAGGAGG - Intergenic
1107753196 13:43591473-43591495 ACATAAAAGGCACAGAAAGGAGG + Intronic
1109305479 13:60636215-60636237 ACATAAAAGGTACAACTTTTAGG - Intergenic
1113717451 13:112522396-112522418 CAATAAAAAGTACAGCTTGCTGG - Exonic
1116801388 14:49447726-49447748 ACATACAATTAACAGCTTGGAGG + Intergenic
1117008318 14:51444890-51444912 ACTTAAAAGGAACAGCTCTGAGG - Intergenic
1117622445 14:57600937-57600959 ACTGAAAAGGTTCAGCTTGGTGG + Intronic
1117971316 14:61253640-61253662 ACAGCAAAGGCAGAGCTTGGTGG + Intronic
1121868812 14:97388370-97388392 GCATAAAAGTCACAGCTTGCAGG - Intergenic
1124697916 15:31881719-31881741 ACTTAAAATGTACAGATTGATGG + Intergenic
1126595219 15:50377986-50378008 ACATAAGAGATAAGGCTTGGGGG + Intergenic
1126792721 15:52235656-52235678 AGTTAAAAGGTAAAGCTTGGGGG - Exonic
1129091378 15:73154796-73154818 ACTTAAAAGATATAGATTGGTGG - Intronic
1130868228 15:87950091-87950113 ACATCACAGGGACGGCTTGGGGG - Intronic
1131745519 15:95443122-95443144 AAATAACATGTAGAGCTTGGGGG + Intergenic
1131881524 15:96867639-96867661 ACATAAGAGGGATAGCTTGATGG + Intergenic
1132138950 15:99373246-99373268 ACATAAAAAGTGCATTTTGGGGG - Intronic
1136034070 16:27525454-27525476 ACAAAGAAGGAACAGCTGGGAGG - Intronic
1136279480 16:29199553-29199575 ACTTTTAAGGTACAGTTTGGTGG + Intergenic
1138110663 16:54321215-54321237 TCATTAAAGGGCCAGCTTGGTGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141391164 16:83665463-83665485 ACATAAAAGATACAGCTTATTGG - Intronic
1148407396 17:47429061-47429083 AAATAGAAGGTATAGCTTGCTGG - Intronic
1153158784 18:2179570-2179592 ACTTCAGAGGTACAGCTTGTTGG + Intergenic
1154264334 18:12866676-12866698 ACCTAAAAGGTACAGTTTAGTGG - Intronic
1155665474 18:28303024-28303046 ACTTAAAAGATATAGATTGGTGG + Intergenic
1156803791 18:41151476-41151498 ACATATAAGGTACAATTTGAGGG - Intergenic
1157755141 18:50210951-50210973 ACAAAAAAAATACAGCATGGTGG - Intergenic
1159755978 18:72366387-72366409 ACAGAAAATGTGCAGCGTGGTGG + Intergenic
1166234567 19:41446291-41446313 AAAAAAAAAGGACAGCTTGGAGG + Intergenic
924973253 2:150777-150799 ACAGAAAATGTACATGTTGGGGG - Intergenic
925428103 2:3768009-3768031 TAATAAAAGGTTCAGCTTGTAGG + Intronic
925574333 2:5345195-5345217 ACATAAAGGCTACAGTTTGCTGG - Intergenic
925656557 2:6156105-6156127 ACTTCAAAGGGACAGCTTGACGG + Intergenic
926554721 2:14342892-14342914 ACATAAAAGATAAAGCTTTTAGG + Intergenic
928654724 2:33438912-33438934 AAATACAATGTACAACTTGGGGG + Intronic
929138130 2:38643912-38643934 ACACAACAGGTACAGAGTGGAGG + Intergenic
932556541 2:72829744-72829766 ACTTCAAAGGGACAGCTTGATGG + Intergenic
935286553 2:101568907-101568929 ACATAAAAGGCAGAATTTGGGGG - Intergenic
936380306 2:111979204-111979226 ACATAAAAAGTAAAGATTGTGGG + Intronic
938729887 2:134138903-134138925 ACTGATAAGGTACAGATTGGGGG + Intronic
939372331 2:141317381-141317403 ACACAGAGGGTACAGCTTGAAGG - Intronic
939504308 2:143026883-143026905 ACTTCAGAGGGACAGCTTGGTGG - Intronic
941352475 2:164453755-164453777 ACATAAAAACAAAAGCTTGGGGG - Intergenic
942262658 2:174185042-174185064 ACATAAATGGTCCAGCTTGGTGG + Intronic
942818945 2:180087790-180087812 TCATAAATGGTACAGATTAGGGG + Intergenic
944001370 2:194842591-194842613 ACTTCAGAGGTACAGCTTGATGG + Intergenic
945126030 2:206511032-206511054 AGATAAAAGATACATCTTGTTGG - Intronic
945145105 2:206729778-206729800 AGATATAAGGTACAGCCAGGAGG + Intergenic
945445374 2:209931875-209931897 ACATAAACAGTACATTTTGGTGG + Intronic
945840836 2:214886223-214886245 ACATAAAAGGTACAGCTTGAGGG + Intergenic
949002729 2:241626153-241626175 ATAAAAAAACTACAGCTTGGTGG + Intronic
1170241579 20:14172603-14172625 ACATAAAAGATACAGAATGCTGG - Intronic
1171503636 20:25614986-25615008 AAAAAAAAGGAACAGATTGGGGG + Exonic
1172741392 20:37170572-37170594 AAAGAAAATGTACAGTTTGGTGG + Intronic
1173000693 20:39103330-39103352 AAATAAAATGTATAGATTGGAGG + Intergenic
1173232015 20:41205767-41205789 ACAGAAAATGTATAGCTTGCTGG - Intronic
1175617883 20:60418258-60418280 ACTTAAAAGATACAGACTGGTGG - Intergenic
950319438 3:12036427-12036449 GCATAAATGGTAAACCTTGGTGG - Intronic
951671427 3:25187334-25187356 AGATAACAGGTACTTCTTGGTGG + Intronic
951885421 3:27519458-27519480 ACATAATAGGTAGAGATTGGTGG - Intergenic
955456613 3:59128624-59128646 ACATAAAAGGAAAAGTTTGAGGG - Intergenic
956086989 3:65621966-65621988 ACTTACAAGGCACAGCATGGCGG + Exonic
957257137 3:77852623-77852645 ACATAAAGTGTACAGGTTAGTGG + Intergenic
957541394 3:81574521-81574543 AGAGAAAAGGTACAGCATAGTGG - Intronic
958127510 3:89376426-89376448 ATTTTAAAGGTACAACTTGGAGG - Intronic
958514746 3:95099928-95099950 ACATAAAAGGCAGAGGTTGCAGG - Intergenic
959483968 3:106907021-106907043 ACATAAAAGGTCAAGCTTTCTGG + Intergenic
962569333 3:136696157-136696179 ACTTACCAGTTACAGCTTGGTGG - Intronic
963285301 3:143429459-143429481 AGATAAAAGGCAGAGCCTGGCGG + Intronic
964052734 3:152416620-152416642 ACAGAGAGGGTACAGCCTGGTGG - Intronic
964105361 3:153033915-153033937 AGAAAAAAGGCCCAGCTTGGTGG - Intergenic
965171598 3:165271770-165271792 GTATAAAAGGTACAACTGGGTGG + Intergenic
965599965 3:170444774-170444796 ACAAAAAAGGTACAACCTTGGGG - Intronic
965781641 3:172292508-172292530 ACATAAAAGGTAGAGTTTAAAGG + Intronic
965848713 3:172994997-172995019 ATATAAAAGGTGGAGCTTGAGGG + Intronic
966141345 3:176759958-176759980 ACATAATAGTTTCAGGTTGGTGG + Intergenic
969093071 4:4710796-4710818 ACAAAAAAGATGCAGCTTAGCGG - Intergenic
969928245 4:10605527-10605549 ATAAAAAAGGTACACCTGGGTGG + Intronic
971049764 4:22848523-22848545 ACATAAAAGGTACAGGTCCAAGG - Intergenic
971147225 4:23991527-23991549 TCATAAAAGGAAAAGCTGGGTGG + Intergenic
971819798 4:31537402-31537424 ACATAAAAGATACAATTTGGTGG - Intergenic
972964218 4:44489409-44489431 ACATAAATTGTACAGTTTGAAGG - Intergenic
972978255 4:44663806-44663828 ACCTAAAGGGTAGAGCCTGGGGG + Intronic
973659357 4:53087287-53087309 ACATAGAAGGTAGAACTTGTGGG + Intronic
973945429 4:55949710-55949732 ACATAAAAGGTTAGGTTTGGGGG - Intronic
975386238 4:73763497-73763519 ACTTCAAAGGGACAGCTTGATGG + Intergenic
975677517 4:76841922-76841944 ACATAAAAGGCCGAGCATGGTGG - Intergenic
975905035 4:79199688-79199710 ACAAAAAAGGGAGAGCTTTGTGG + Intergenic
976001281 4:80375632-80375654 ACATAAAAGGAAAAGTGTGGAGG + Intronic
978709543 4:111762459-111762481 ACCTAAAAAGTAGAGCTTAGGGG + Intergenic
979545992 4:121940497-121940519 ACATAAGAGGAACATCCTGGAGG - Intronic
979903212 4:126249947-126249969 ACATGAAAGGTACAGTCTTGTGG + Intergenic
980329558 4:131392273-131392295 AAAAAAAAGCTACAGCCTGGAGG + Intergenic
981004918 4:139864955-139864977 ACATAACAAGTAAAGCTTTGTGG - Intronic
981101093 4:140829796-140829818 CCATAGAAGGAACAGCATGGAGG + Intergenic
982108139 4:152029094-152029116 ACACAAAAGGTTCACCTTGCAGG - Intergenic
983976367 4:173939349-173939371 ACATTGAAGGCAAAGCTTGGGGG - Intergenic
988146813 5:27319765-27319787 ACATAAAAGATATAATTTGGGGG + Intergenic
994510064 5:100691125-100691147 ATATAAAAAGTCAAGCTTGGGGG - Intergenic
994726626 5:103443952-103443974 ACATAAAAGGGTCAGCTGAGTGG + Intergenic
995998984 5:118334734-118334756 ACTTAAAAGATATAGATTGGTGG + Intergenic
997629298 5:135354643-135354665 ACAGAAAAGAGACAGCATGGGGG + Intronic
998066094 5:139160183-139160205 ACACAAAAGTTATAGCCTGGAGG + Intronic
1000168777 5:158681091-158681113 ACTTAAAAGGTAGGGCATGGTGG - Intergenic
1002456293 5:179346772-179346794 ACAGAAAGAGTACAGCTTGCAGG - Intergenic
1004332606 6:14735482-14735504 ACTTAAAAGTTAAGGCTTGGAGG + Intergenic
1009644576 6:66381632-66381654 ACATAAAAGATAGAGAATGGTGG - Intergenic
1010967209 6:82224892-82224914 ACTTAAAAGATGCAGTTTGGTGG + Intronic
1011835799 6:91430303-91430325 ACAGGAAAGGTACAGGGTGGTGG + Intergenic
1012216653 6:96593818-96593840 ACTTAAAAAGTGTAGCTTGGAGG - Intronic
1013351835 6:109312878-109312900 ACATGAAGGGGACAGCCTGGAGG - Intergenic
1014870488 6:126589791-126589813 ACTTAAAAGATACAAATTGGTGG - Intergenic
1015940936 6:138451207-138451229 AGGTACAAGGTACAGCATGGAGG - Intronic
1018624337 6:165763288-165763310 ACATAAAAGGAACATCATGGAGG - Intronic
1019283659 7:212839-212861 ACTTAAAGTGTGCAGCTTGGGGG + Intronic
1021108209 7:16664183-16664205 ATATAAAAGATACAGAATGGAGG + Intronic
1021406252 7:20270548-20270570 TCAAGAAAGGAACAGCTTGGAGG + Intergenic
1021687915 7:23205595-23205617 ATATAAAAGGTACACATTTGTGG + Intergenic
1026368043 7:69669635-69669657 TCATAAAAGGTACATTTTGTTGG + Intronic
1026445585 7:70481956-70481978 AAATAAAATTTACAGCTTGATGG + Intronic
1026473467 7:70713902-70713924 AAAAAAAAGATACAGCTTGCGGG + Intronic
1026826508 7:73585544-73585566 AAAAAAAAAGTACAGCTTGCTGG - Intergenic
1028367309 7:90048716-90048738 ACATAATAGACACATCTTGGGGG - Intergenic
1029315995 7:99714541-99714563 ACACAAAAGGTAAAACGTGGTGG - Exonic
1030178400 7:106678858-106678880 ACATAGAAAGTAAAGCTTAGTGG + Intergenic
1031458391 7:122012883-122012905 ACAAAGAAGGTACCACTTGGTGG - Exonic
1033649262 7:143328443-143328465 ACATAAAATGTGCAGCTAAGAGG - Intronic
1035136261 7:156705967-156705989 TCTTAAAAGATACAGATTGGTGG + Intronic
1036290431 8:7483583-7483605 ACATAAAACTTACAGCCAGGTGG + Intronic
1036331055 8:7827952-7827974 ACATAAAACTTACAGCCAGGTGG - Intronic
1038043084 8:23743113-23743135 ACAGAAAAGGAACAGGTTTGGGG - Intergenic
1040879834 8:52192677-52192699 ACAAAAAAGGTACAGTTAGGAGG + Intronic
1042591097 8:70400074-70400096 ATATAAAATGTAAGGCTTGGAGG - Intronic
1046172875 8:110534659-110534681 GCATTAAAGATACAGTTTGGTGG - Intergenic
1047038021 8:120960920-120960942 AGGTAAAACGTACAGCGTGGAGG + Intergenic
1048014747 8:130487237-130487259 AAATAAAAGGTATAGTTTGATGG - Intergenic
1050656839 9:7837685-7837707 TCAAACAAGGTCCAGCTTGGTGG - Intronic
1056050313 9:82761847-82761869 ACATAAAAGTTACATGTTGATGG - Intergenic
1056577192 9:87864936-87864958 AAATAAGAGGTACAGGTTAGAGG + Intergenic
1057563379 9:96146584-96146606 ACAAAACAGGTACAGACTGGAGG + Intergenic
1057818825 9:98315730-98315752 ACATGAAGGGTCCAGCCTGGTGG + Intronic
1058394196 9:104531084-104531106 ATATAAAAGGTACAGTTTCATGG + Intergenic
1059114332 9:111587206-111587228 ACAGAAAGGGTGCAGCTTAGAGG - Intronic
1060118396 9:120964928-120964950 ACATAAAAGAGACAGGCTGGCGG + Intronic
1060717458 9:125945826-125945848 AGGTTAAAGATACAGCTTGGAGG + Intronic
1061101454 9:128495673-128495695 ACATAACAGGTAAAGCTCTGTGG + Intronic
1062705547 9:137938449-137938471 ACTTAAAAGATACAGAATGGTGG + Intronic
1186784776 X:12947197-12947219 TCATAAAAGGAGCAGTTTGGAGG + Intergenic
1189737008 X:44081461-44081483 ACAGAAGATGTACAGCTTGAGGG + Intergenic
1191151729 X:57227329-57227351 ACATAAAGGGAACAGCCTGTGGG - Intergenic
1191887162 X:65900592-65900614 ACATCAAGGGAACAGCATGGAGG - Intergenic
1191984356 X:66962530-66962552 ACAGAAAAAGTACTGCTTAGAGG - Intergenic
1192904183 X:75532572-75532594 TCTTAAAAGATACAGATTGGTGG - Intergenic
1193077096 X:77365477-77365499 ACATCAAAGGAACAGCCTGTGGG + Intergenic
1193368226 X:80660131-80660153 AAATAAAAGTGACAGCTTAGAGG - Intergenic
1193501443 X:82279861-82279883 AATTAACAAGTACAGCTTGGAGG + Intergenic
1196272111 X:113724342-113724364 ACATAAGATGTACAATTTGGGGG - Intergenic
1197090960 X:122536731-122536753 ACAGCTAAGGTAGAGCTTGGGGG + Intergenic
1197371432 X:125630498-125630520 ACTGAAAAGATACAGATTGGTGG + Intergenic
1197604034 X:128563419-128563441 ACTTAAAAGATACAGAATGGTGG + Intergenic
1198482039 X:137050400-137050422 AGATAAAAGGCACAGTGTGGAGG - Intergenic
1200297044 X:154930553-154930575 ACAAAAATGCTACAGCTTTGAGG - Exonic
1200395109 X:155981195-155981217 ACATAAAGGGTTCAATTTGGGGG - Intergenic