ID: 1087071521

View in Genome Browser
Species Human (GRCh38)
Location 11:94086140-94086162
Sequence TTGTGGCCATGTGGGGAAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 389}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087071521_1087071531 29 Left 1087071521 11:94086140-94086162 CCTGTTTCCCCACATGGCCACAA 0: 1
1: 0
2: 5
3: 34
4: 389
Right 1087071531 11:94086192-94086214 AAACTTGCTGGGTCCATCTCAGG 0: 1
1: 0
2: 1
3: 4
4: 110
1087071521_1087071526 5 Left 1087071521 11:94086140-94086162 CCTGTTTCCCCACATGGCCACAA 0: 1
1: 0
2: 5
3: 34
4: 389
Right 1087071526 11:94086168-94086190 TTCATGCAGCCAGACCATGCAGG 0: 1
1: 0
2: 0
3: 13
4: 122
1087071521_1087071529 18 Left 1087071521 11:94086140-94086162 CCTGTTTCCCCACATGGCCACAA 0: 1
1: 0
2: 5
3: 34
4: 389
Right 1087071529 11:94086181-94086203 ACCATGCAGGTAAACTTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 88
1087071521_1087071528 17 Left 1087071521 11:94086140-94086162 CCTGTTTCCCCACATGGCCACAA 0: 1
1: 0
2: 5
3: 34
4: 389
Right 1087071528 11:94086180-94086202 GACCATGCAGGTAAACTTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087071521 Original CRISPR TTGTGGCCATGTGGGGAAAC AGG (reversed) Exonic
900745850 1:4360366-4360388 TTCTGGCCATCTGGGGAACGTGG - Intergenic
901988164 1:13092119-13092141 TTTAGTCCATGTGGGGACACAGG + Intergenic
901993648 1:13134648-13134670 TTTAGTCCATGTGGGGACACAGG - Intergenic
902331769 1:15734378-15734400 TCCTGGCCACGTGGGGAAGCGGG + Exonic
903747934 1:25601203-25601225 TTGACTCCATGTGGGTAAACAGG + Intergenic
904453281 1:30630603-30630625 TTGTGGCTCTGTGGGGATAAGGG - Intergenic
908034538 1:60037760-60037782 TTTCTGCCATGTGGGGATACAGG + Intronic
908318400 1:62957288-62957310 ATAAAGCCATGTGGGGAAACTGG + Intergenic
909095937 1:71289539-71289561 TTGTATTCATATGGGGAAACGGG - Intergenic
909606352 1:77512500-77512522 TTGTTGACATTTGGGGGAACGGG + Intronic
909684205 1:78328432-78328454 TTTAGGCCATGATGGGAAACAGG + Intronic
912602446 1:110950656-110950678 ATGTGGGCATGTTGGGTAACTGG + Intronic
912980104 1:114363684-114363706 TTGGGGCCATGTTTGGAAAATGG - Intergenic
913313680 1:117531496-117531518 TAGTGGAGATGTGGAGAAACTGG - Intergenic
913507486 1:119531228-119531250 TGGTGAAGATGTGGGGAAACAGG - Intergenic
913793894 1:122578522-122578544 TTGTGGCCTTCGTGGGAAACGGG + Intergenic
913803587 1:122752587-122752609 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913808334 1:122838270-122838292 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913812000 1:122903880-122903902 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913814513 1:122949109-122949131 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913814771 1:122953866-122953888 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913814852 1:122955223-122955245 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913821065 1:123065671-123065693 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913822004 1:123082667-123082689 TTGTGGCCTTCAGTGGAAACGGG + Intergenic
913822770 1:123096264-123096286 TTGTGGCCTTCAGTGGAAACGGG + Intergenic
913825938 1:123153197-123153219 TTGTGGCCTTGGTTGGAAACGGG + Intergenic
913829276 1:123213042-123213064 TTGTGGCCATCTTTGGAAACGGG + Intergenic
913830929 1:123243251-123243273 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913831776 1:123258537-123258559 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913834997 1:123315649-123315671 TTGTGGCCTTGTTTGGAAACCGG + Intergenic
913837577 1:123361525-123361547 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913838011 1:123369342-123369364 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913840837 1:123419972-123419994 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913845170 1:123497636-123497658 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913846756 1:123526530-123526552 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913850517 1:123594156-123594178 TTGTGGCCTTCAGTGGAAACGGG + Intergenic
913854696 1:123669286-123669308 TTGTGGCCTTGGTTGGAAACGGG + Intergenic
913855218 1:123678805-123678827 TTGTGGCCTTCAGTGGAAACGGG + Intergenic
913858952 1:123746267-123746289 TTGTGGCCTTGTTTGGAAACCGG + Intergenic
913881275 1:124145741-124145763 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913885896 1:124228293-124228315 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913887880 1:124263801-124263823 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913891169 1:124322955-124322977 TTGTGGCCTTCGTGGGAAACGGG + Intergenic
913893974 1:124372940-124372962 TTGTGGCCTTGGTTGGAAACGGG + Intergenic
913900791 1:124495131-124495153 TTGTGGCCATCGTTGGAAACGGG + Intergenic
913906674 1:124600823-124600845 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913912748 1:124709596-124709618 TTGTGGCCTTCTTTGGAAACGGG + Intergenic
913915926 1:124766691-124766713 TTGTGGCCTTGGTTGGAAACGGG + Intergenic
915812609 1:158930683-158930705 ATGTGGCCATGAGTGGAAAATGG - Intergenic
916078693 1:161218533-161218555 TTGTAGCCATGTGGGCAAACAGG + Intronic
916544600 1:165791634-165791656 TTGGGGACAGTTGGGGAAACTGG + Intronic
918135513 1:181670547-181670569 TTGAGGGCATTTGGGGCAACTGG + Intronic
919397432 1:197068775-197068797 TTGTGGCTCTGTGGGGAATGGGG - Intergenic
920871629 1:209799715-209799737 TTGTGGCCATGGTCTGAAACTGG - Intronic
922702568 1:227770364-227770386 TTCTGGGCATGTGGGGAGCCAGG + Intronic
924313351 1:242770231-242770253 ATGTAGGCATTTGGGGAAACAGG + Intergenic
924567790 1:245212458-245212480 TTGTGTCAATGTGGGGGATCTGG - Intronic
924705748 1:246500571-246500593 GTGTTGCCATTTGGGGAATCAGG + Intronic
1063118861 10:3090479-3090501 GTGTGGCCAGGTAGGGAAACGGG + Intronic
1063490255 10:6457560-6457582 ATGTGGCCACTGGGGGAAACTGG + Intronic
1064854393 10:19749302-19749324 TTGTGACAATATGGAGAAACTGG - Intronic
1065441679 10:25759018-25759040 TTGTGGACCTGTGAAGAAACTGG - Intergenic
1066036102 10:31486358-31486380 CTGTGGCCATGTAGAGAAAGTGG - Intronic
1066536095 10:36393871-36393893 TTGTGAAGATGTGGGGAAATTGG + Intergenic
1066935079 10:41819041-41819063 TTGTGGCCATAAGGTGAAAAAGG - Intergenic
1068643886 10:59443985-59444007 TAGTGGGAATGTGGGGAAAAGGG + Intergenic
1073530141 10:104223190-104223212 CTGTGACCATGTGGGAATACAGG + Intronic
1073629289 10:105132182-105132204 TTATGTACAGGTGGGGAAACAGG - Intronic
1074573626 10:114648003-114648025 TTGTGTACATATGGGAAAACTGG + Intronic
1076659372 10:132045153-132045175 TTGTGAGGATGTGGGGAAACTGG - Intergenic
1077289948 11:1784424-1784446 GTGTGGCCCTGTGGGGACACAGG - Intergenic
1080871974 11:36244371-36244393 ATGTGGCAATGTGTAGAAACTGG - Intergenic
1081063655 11:38511569-38511591 TTGTGACAATGTGGAGAAATTGG - Intergenic
1081481675 11:43495611-43495633 TTGTGGTGAGGTGGGGAAGCAGG - Intergenic
1082157314 11:48840093-48840115 TTGAGGCCTTCAGGGGAAACGGG + Intergenic
1082163652 11:48914688-48914710 TTGAGGCCATCTTTGGAAACGGG - Intergenic
1083635276 11:64117491-64117513 TTTTGGCCTTGAGGGTAAACAGG - Exonic
1084095474 11:66908337-66908359 TTCTGGCCCTGTGGGGAGACAGG - Intronic
1084676008 11:70635060-70635082 TGGTGAGTATGTGGGGAAACTGG + Intronic
1085553975 11:77402726-77402748 ATGTGGCAATGTGGGAAATCAGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087071521 11:94086140-94086162 TTGTGGCCATGTGGGGAAACAGG - Exonic
1087809707 11:102597074-102597096 ATGAGGCCATGTGGGGAAAGTGG + Intronic
1087833074 11:102840822-102840844 TTGGGGCCATGGGGGGCAAGTGG - Intronic
1089370460 11:117952029-117952051 GTGTGGCCAGGTGGGGTCACAGG + Intergenic
1089571283 11:119412213-119412235 ATGTTGCCATTGGGGGAAACTGG - Intergenic
1089794996 11:120973128-120973150 TTTTGGCCATGTGGTGGAAATGG + Intronic
1091879526 12:3965662-3965684 TTGTGGTCATGTAGGGATGCAGG - Intergenic
1092256289 12:6928191-6928213 TTGGGGCCAGGCGGGGAAAAGGG + Intronic
1094366863 12:29692506-29692528 TGGTGAAAATGTGGGGAAACTGG + Intronic
1094878427 12:34680573-34680595 TTGAGGCCATCTTTGGAAACGGG + Intergenic
1098731515 12:74041053-74041075 TGGAGGTCAAGTGGGGAAACAGG + Intergenic
1101071654 12:101081956-101081978 ATGTGACCATATGTGGAAACAGG - Intronic
1102049511 12:109852503-109852525 TCGTGGCCACATGGAGAAACAGG - Exonic
1102194213 12:111012986-111013008 TTGGGGCCATTAGGGGAAGCAGG - Intergenic
1102488248 12:113272768-113272790 CTGTGGCCATATGGGGAAGGGGG + Intronic
1102657281 12:114492674-114492696 TTATGGCAATTTGGGGCAACAGG - Intergenic
1103729369 12:123016681-123016703 TGGTTGGCATGTGGAGAAACTGG + Intronic
1104070141 12:125337532-125337554 TTGTGGCCATACGTGGATACAGG + Intronic
1104283019 12:127395339-127395361 TTGTGGCCACTGAGGGAAACTGG + Intergenic
1104688625 12:130807430-130807452 TTGTGCCCATGAGGGGACCCAGG + Intronic
1104688640 12:130807487-130807509 TTGTGCCCATGAGGGGACCCAGG + Intronic
1104688655 12:130807544-130807566 TTGTGCCCATGAGGGGACCCAGG + Intronic
1105080067 13:16101750-16101772 TTGATGCCTTCTGGGGAAACAGG + Intergenic
1106505963 13:30370671-30370693 TTCAGGCCATGGGGGGAACCAGG - Intergenic
1106551866 13:30778971-30778993 ATGTGGCAATGTTGGGAAAGGGG + Intergenic
1107835229 13:44407543-44407565 TTGTGGCCAGGTGGGGGCACTGG - Intergenic
1109361575 13:61300242-61300264 TTGTGGCCATTAGGAGAAAGCGG - Intergenic
1109645368 13:65247039-65247061 TTGTGTCCATGTGGGGTCATGGG + Intergenic
1110890182 13:80688999-80689021 TTGTGGGCATGTGGTGGAAGGGG + Intergenic
1112364054 13:98741938-98741960 TAGAAACCATGTGGGGAAACTGG + Intronic
1112502751 13:99955403-99955425 CTGTGGCCCTGTGGTGAGACAGG - Intergenic
1113354717 13:109567374-109567396 TTATGGCCATGTGTGCAAATGGG + Intergenic
1113809394 13:113129215-113129237 TTGAGGCCATGAGGGGAAGCAGG - Intronic
1113973031 13:114205180-114205202 TGGTGACCATGTGGGGAAATTGG + Intergenic
1114649893 14:24277818-24277840 TGCTGGCCTTGTGGGGAAGCGGG + Intergenic
1115464716 14:33702516-33702538 TTGGGTCCATGTGAGGAAAGTGG + Intronic
1116788016 14:49309346-49309368 CTGTGGCCTTGTGGGAAATCTGG - Intergenic
1116870787 14:50067648-50067670 GTGTGACCGTGTGGGGAAATGGG - Intergenic
1118073466 14:62271450-62271472 CTGGGGCTAAGTGGGGAAACTGG - Intergenic
1119464200 14:74841503-74841525 TTGTGGCCATGTGGGGATATAGG + Intronic
1119735760 14:76980732-76980754 CTGTGGCCACCTGTGGAAACTGG + Intergenic
1120126226 14:80747089-80747111 TTGTGTAGATGTGGAGAAACTGG + Intronic
1122824200 14:104361797-104361819 TTCTGGCATTCTGGGGAAACTGG + Intergenic
1123702218 15:22923473-22923495 TGGTGTGGATGTGGGGAAACTGG + Intronic
1123917584 15:25048307-25048329 TGGTGACAATGTGGAGAAACTGG - Intergenic
1123940714 15:25215342-25215364 GGGTCGCCATGTGGGGAGACAGG - Intergenic
1124055087 15:26234906-26234928 GTGTTACCATTTGGGGAAACTGG - Intergenic
1124216636 15:27812938-27812960 TAGTGGGCATGTGGGGAAGTGGG - Intronic
1125085821 15:35728061-35728083 TTGTGGCGATCTGGGCAACCTGG + Intergenic
1127168972 15:56278686-56278708 TTTTGGGCCTGTGGGGAAAGTGG - Intronic
1127258586 15:57311191-57311213 CTGGGGCCATGCTGGGAAACAGG + Intergenic
1128674175 15:69596619-69596641 GTGGGGCCACCTGGGGAAACAGG + Intergenic
1128867635 15:71126389-71126411 TAGAGGCCAAGTGGGGAACCTGG + Intronic
1129273255 15:74430416-74430438 CTTTGGGCATTTGGGGAAACTGG + Intronic
1130902949 15:88220680-88220702 TTGTGGCCATGTGCAGGAAATGG - Intronic
1131228979 15:90646769-90646791 TTGGAGCCCTGTGGGGAAGCTGG - Intergenic
1131431024 15:92389184-92389206 TTGTAGGCATCTGAGGAAACTGG - Intergenic
1131993149 15:98109730-98109752 ATGGGGCCATGTGGGGTAACAGG - Intergenic
1132600648 16:771114-771136 ATGTGACCTTGTTGGGAAACAGG + Intronic
1134217850 16:12330249-12330271 TGGTCGCCAGGTGAGGAAACAGG - Intronic
1137297142 16:47105830-47105852 TGGTGAACATGTGGAGAAACTGG + Intronic
1137393144 16:48097987-48098009 TGATGCCCATGTGGGGGAACTGG - Intronic
1137878568 16:52021830-52021852 TTGTGGCCAGGTGAGGGGACTGG - Intronic
1138181573 16:54944015-54944037 TAGTGGCAACGTGGGGAAAAGGG + Intergenic
1138214924 16:55195792-55195814 TGGTGAGAATGTGGGGAAACTGG + Intergenic
1140306322 16:73806475-73806497 TTGGGGCAATATGGGGAAAGTGG + Intergenic
1141086584 16:81100074-81100096 ATGTGACCATATTGGGAAACAGG + Intergenic
1141466857 16:84211813-84211835 TTGTGGCCATGAGGAGAAACTGG + Intergenic
1143003258 17:3809198-3809220 TGGTGGAGATGTGGAGAAACTGG + Intergenic
1144248041 17:13387044-13387066 TGGTGGCCATGTGGAGGAGCTGG - Intergenic
1145723689 17:27096986-27097008 TGGTGGGCATGTGGTGAAAAGGG - Intergenic
1146672764 17:34753212-34753234 TTCTAGCCAAGAGGGGAAACAGG - Intergenic
1147120071 17:38330609-38330631 TTGGGGCTTTGTGGGGATACTGG + Exonic
1147160346 17:38566006-38566028 CTGTGGCAGTGTGGGGAACCAGG + Intronic
1147576078 17:41599787-41599809 TTGTGGCCATGTGGGCAGATAGG + Intergenic
1147869960 17:43580132-43580154 ATGTTACCATGAGGGGAAACTGG - Intergenic
1147932289 17:43989506-43989528 TTGTGAGGATGTGGAGAAACTGG - Intronic
1148121726 17:45216671-45216693 TTGTGAGGATTTGGGGAAACAGG + Intergenic
1148682218 17:49481019-49481041 GTGTGGCCATGTGAGCAAAGCGG - Intergenic
1150604075 17:66676102-66676124 TTGTGGCGACGTGAGGGAACTGG + Intronic
1151582728 17:74989223-74989245 TCTTGGCCATGTGGGGAAGTAGG - Intronic
1151809885 17:76432938-76432960 TGGTGAGCATGTGGAGAAACTGG + Intronic
1152028886 17:77829788-77829810 TGGTGACCATGTGGAGAGACAGG - Intergenic
1152484092 17:80578430-80578452 GTTTGGCCATGTTGGGAAGCTGG - Intronic
1153376818 18:4390280-4390302 TTGTGAACATGTGGGGACAGGGG - Intronic
1153924451 18:9823496-9823518 ATGTGACCATTTAGGGAAACTGG + Intronic
1154253678 18:12765345-12765367 TAGAGGCCATGTGAGGACACAGG + Intergenic
1154402553 18:14055019-14055041 TGGTGAGCATGTGGAGAAACTGG - Intergenic
1155217821 18:23658816-23658838 TCTTGGTCATGTGAGGAAACGGG + Intronic
1155810660 18:30229582-30229604 TGGTGGGGATGTGGGGAAAAAGG + Intergenic
1157708621 18:49831616-49831638 TGGTGAGGATGTGGGGAAACTGG + Intronic
1159149675 18:64505161-64505183 TTTTAGCCATGAGGGGAAGCTGG - Intergenic
1159703715 18:71661198-71661220 AAGTAGCCATGTGAGGAAACTGG - Intergenic
1161398245 19:4056079-4056101 TTGTGTACAGCTGGGGAAACAGG - Intronic
1162480347 19:10923784-10923806 TGGTGGCTGTGTGGGGACACTGG - Intronic
1163567149 19:18058569-18058591 TGGTGGCCATGGGGAGAATCTGG + Intergenic
1163736836 19:18986812-18986834 TTGTGGCCAGGTGTGAAAAGGGG - Intergenic
1164881792 19:31738959-31738981 TTCTGGCCCTATGGGGAAAATGG + Intergenic
1165911411 19:39230551-39230573 TTGTGCCTATGAGGGGAGACAGG - Intergenic
1168190538 19:54735388-54735410 TCAGGGCCATGTGGGGAAGCAGG + Intronic
1168192759 19:54751784-54751806 TCAGGGCCATGTGGGGAAGCAGG + Intronic
1168194845 19:54766612-54766634 TCAGGGCCATGTGGGGAAGCAGG + Intronic
1168197095 19:54783054-54783076 TCAGGGCCATGTGGGGAAGCAGG + Intronic
1168202893 19:54829496-54829518 TCAGGGCCATGTGGGGAAGCAGG + Intronic
1168205454 19:54847319-54847341 TCAGGGCCATGTGGGGAAGCAGG + Intronic
1168207918 19:54865940-54865962 TCAGGGCCATGTGGGGAAGCAGG + Intronic
925993471 2:9272192-9272214 TTGTGGGGATGTGGAGAAAAGGG - Intronic
926872553 2:17438981-17439003 TTTTCCCCATCTGGGGAAACTGG - Intergenic
928469885 2:31563753-31563775 TTGTGGCCATGTGTGATCACTGG - Intronic
929068142 2:38001004-38001026 GTGTGGCAATGTTGGGAGACAGG + Intronic
929561185 2:42957581-42957603 CTGTGGCCATCTGGGGAGCCAGG - Intergenic
931017829 2:58006153-58006175 TGGGGGACATGTGTGGAAACTGG + Intronic
931092076 2:58896929-58896951 TTGTTGCCATGTGGAGAGGCAGG - Intergenic
931224065 2:60314081-60314103 TTGAGGCCAGGTTGAGAAACAGG - Intergenic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
932083745 2:68739050-68739072 TTCTGGCCATTTGAGGAAAAAGG + Intronic
932168514 2:69531485-69531507 TTGTGGACATGAGGAGAAAATGG + Intronic
932525608 2:72463952-72463974 TTGTGGCCATGTGAGGATACGGG - Intronic
933238533 2:79893222-79893244 TAGTGGCCATGTGAGAAAACGGG - Intronic
933650750 2:84848074-84848096 TTGTGACTATGTTTGGAAACAGG - Intronic
934923098 2:98361662-98361684 TTGTGGGGCTGTGGAGAAACAGG - Intronic
935809714 2:106785780-106785802 TTCTGGCAATATGGGGAAATAGG + Intergenic
936147358 2:109989104-109989126 TTGTGAGAATGTGTGGAAACTGG - Intergenic
936197334 2:110382380-110382402 TTGTGAGAATGTGTGGAAACTGG + Intergenic
936953519 2:118001995-118002017 TTGTGGACATCTGGAGAAATAGG + Intronic
937761968 2:125615548-125615570 TGGTGGCGATGTGGTGAAAAGGG + Intergenic
938050111 2:128161988-128162010 TTGTGAGGATGTGGAGAAACCGG - Intronic
940365102 2:152839562-152839584 TTGTGTGGATGTGGGGAAAAGGG - Intergenic
940859806 2:158760034-158760056 TTGTGGCCTGGTGGGTACACTGG + Intergenic
940942177 2:159574382-159574404 TTGTAAGGATGTGGGGAAACTGG + Intronic
942602278 2:177653501-177653523 ATGTGGCCATGTTTGGAAATAGG + Intronic
943824608 2:192373145-192373167 TTGTAGCCATCTGAGGAAACAGG + Intergenic
944162678 2:196681605-196681627 TTGTGAGGATGTGGAGAAACTGG - Intronic
945065020 2:205941074-205941096 TAGGGGCCATGTGAGGACACAGG - Intergenic
945867788 2:215195870-215195892 TGGTGAGGATGTGGGGAAACAGG + Intergenic
946168278 2:217878469-217878491 TTATGTCCAAATGGGGAAACTGG - Intronic
946420489 2:219561902-219561924 TCGTCGCCATGGGGGGAAGCGGG + Intronic
946503439 2:220274477-220274499 TTGTGGCCAAGTGTGGCATCTGG - Intergenic
947392716 2:229655691-229655713 TTGTGACCCTGTTGGGAAAAGGG + Intronic
947511104 2:230754842-230754864 TTGGGGACTTGTGGGGAAGCGGG - Intronic
948573563 2:238934914-238934936 TGGTGGGAATGTGGAGAAACTGG + Intergenic
948630274 2:239297973-239297995 TGGTGGCCATGTAGGGACAGAGG - Intronic
1168848189 20:959403-959425 TCCTGCCCATGTGGGGAAACAGG - Exonic
1168875328 20:1167973-1167995 TGGTGAAGATGTGGGGAAACTGG - Exonic
1169175264 20:3506186-3506208 ATGTTGCCATTTAGGGAAACTGG + Intronic
1169561833 20:6809649-6809671 TAGTGACGATGTGGGGAAATTGG - Intergenic
1169923065 20:10755956-10755978 ATGTGGGGATGTGGGGAATCTGG + Intergenic
1171505908 20:25633394-25633416 TGGTGACCATGTAGGAAAACAGG + Intergenic
1171574488 20:26290986-26291008 TTGAGGCCTTGTTTGGAAACGGG + Intergenic
1171970561 20:31562403-31562425 TTGTGAACAGGTGGGGAAACTGG + Intronic
1171979893 20:31620249-31620271 AGGTGGCCATGTGGGGCACCAGG - Intergenic
1172050128 20:32110638-32110660 GTGTGGCCATGTTGGGGAATGGG - Intronic
1172640569 20:36437912-36437934 TTGTGGGGATGTGGGGAACAGGG + Intronic
1173523678 20:43716626-43716648 TTGTGCCCCTCTGTGGAAACAGG - Intergenic
1173743268 20:45417447-45417469 TTGTTGCCATGTGGGAATAGAGG + Intronic
1173836453 20:46129059-46129081 GTGTGGCCACGTGGGCAAACAGG + Exonic
1173864447 20:46305450-46305472 TGGGGACCAGGTGGGGAAACAGG - Intronic
1174412557 20:50345473-50345495 CTGTGGTCAGGTGGGGAAACCGG - Intergenic
1174451211 20:50621654-50621676 TTGCCACCATGTAGGGAAACTGG + Intronic
1174552311 20:51370802-51370824 TTGTGGCCATCTGGTGAGAGAGG + Intergenic
1175195193 20:57238586-57238608 TGGTGGACATGTGGAGAAATTGG - Intronic
1175486886 20:59353322-59353344 TTGTTGCCAGGTGGAGACACAGG - Intergenic
1177496238 21:21895588-21895610 TGGTGAGGATGTGGGGAAACTGG - Intergenic
1177863595 21:26485267-26485289 ATGTAACCATCTGGGGAAACTGG - Intronic
1178179634 21:30144924-30144946 TTCAGGCCATGTTGGGAAATGGG + Intergenic
1178504651 21:33152792-33152814 TTCTGGCCATTTGGGGAAGGGGG - Intergenic
1178898481 21:36580292-36580314 TGGTGAGAATGTGGGGAAACTGG + Intergenic
1179295127 21:40054790-40054812 GTGTGGCCAGGTGGGGAACCTGG + Intronic
1181532209 22:23523083-23523105 TTCTGGCCAGGTGGGGAGGCGGG + Intergenic
1181602549 22:23960987-23961009 TTGTGGACACGCGGGGAAACGGG + Intronic
1181605965 22:23980320-23980342 TTGTGGACACGCGGGGAAACGGG - Intronic
1181729786 22:24836583-24836605 TGGTGGGGATGTGGAGAAACTGG - Intronic
1182147343 22:28004654-28004676 GTGTGGGCTTGTGGGGAGACGGG + Intronic
1182470307 22:30544263-30544285 GTGTGGCAATGTGGGGAGAGGGG - Intronic
1183671736 22:39276890-39276912 TGGTGAGGATGTGGGGAAACTGG + Intergenic
1185136655 22:49077296-49077318 TTATGGCCATGAGGGGACAGGGG - Intergenic
1185243440 22:49759708-49759730 TGGTGGCGATGTGGGGAAATTGG + Intergenic
1185311341 22:50156990-50157012 TGGTGAGGATGTGGGGAAACTGG - Intronic
950396405 3:12737372-12737394 TTGTGGCCAGGATGGGGAACTGG - Intronic
950706637 3:14786578-14786600 TGGTGAGGATGTGGGGAAACTGG + Intergenic
952062683 3:29529341-29529363 TTATGGCCATGGGGGCAAAAAGG + Intronic
952204734 3:31169883-31169905 TTGAGGGCATGTGGAGAAAAGGG - Intergenic
952438319 3:33295718-33295740 TGGTGAACATGTGGAGAAACTGG - Intronic
954505851 3:51072292-51072314 TGATGGCCATGTGTGGAGACTGG - Intronic
954892732 3:53946168-53946190 ATGTAACCATGTGGGAAAACAGG - Intergenic
955350579 3:58190369-58190391 TGGTGGCCTTTTGGGGAAAATGG - Intergenic
956280941 3:67556021-67556043 TTCTGGCCATGTGGAGACACTGG + Intronic
958206861 3:90410990-90411012 TTGTGGCCTTCTTTGGAAACGGG - Intergenic
958207070 3:90415054-90415076 TTGAGGCCTTCTGTGGAAACGGG - Intergenic
958209425 3:90451133-90451155 TTGGGGCCTTCTGTGGAAACGGG - Intergenic
958212396 3:90503570-90503592 TTGAGGCCATCTTTGGAAACGGG - Intergenic
958217421 3:90606052-90606074 TTGTGGCCTTCGGTGGAAACCGG - Intergenic
958223157 3:90772919-90772941 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958224297 3:90792457-90792479 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958224403 3:90794157-90794179 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958224508 3:90795857-90795879 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958225227 3:90807749-90807771 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958232231 3:90925838-90925860 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958232536 3:90930936-90930958 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958233047 3:90939430-90939452 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958233771 3:90951323-90951345 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958233972 3:90954721-90954743 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958239709 3:91051561-91051583 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958240012 3:91056657-91056679 CTGAGGCCATCTTGGGAAACGGG + Intergenic
958240118 3:91058358-91058380 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958241018 3:91073644-91073666 CTGAGGCCATCTTGGGAAACGGG + Intergenic
958241338 3:91078743-91078765 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958241993 3:91089793-91089815 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958243916 3:91122075-91122097 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958247459 3:91181550-91181572 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958284248 3:91717702-91717724 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958284445 3:91720592-91720614 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958293654 3:91871481-91871503 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958298999 3:91958483-91958505 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958305237 3:92060894-92060916 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958315711 3:92232223-92232245 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958351112 3:92812577-92812599 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958372304 3:93160279-93160301 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958374583 3:93197530-93197552 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958391545 3:93474887-93474909 TTGTGGCCATTGGTGGAAAAGGG + Intergenic
958401039 3:93630514-93630536 TTGTGGCCATCGTTGGAAACGGG + Intergenic
958405524 3:93753361-93753383 TTGAGGCCTTCTGTGGAAACGGG - Intergenic
958405653 3:93755403-93755425 TTGAGGCCTTCTGTGGAAACAGG - Intergenic
961444724 3:126973990-126974012 ATGTGACCATTGGGGGAAACTGG - Intergenic
961510563 3:127399526-127399548 TTGTGGCAATATAGAGAAACTGG - Intergenic
961638325 3:128349057-128349079 TAGGGGCCATGTGGGGAAACAGG + Intronic
961728815 3:128951983-128952005 CAGTGGCCAAGTGGGGAACCTGG + Intronic
963747407 3:149138878-149138900 TAGTGAGGATGTGGGGAAACAGG + Intronic
963813703 3:149806266-149806288 TAGTGGGCATGTGGAGAAAAGGG - Intronic
964171587 3:153776585-153776607 TTGTGAGGATGTGGGGAAACTGG - Intergenic
964557997 3:157962209-157962231 TTGTGGCCATGCAGGTAAAATGG - Intergenic
965042150 3:163522499-163522521 TTGAAGCCATGTGGAGAAATAGG - Intergenic
965676041 3:171197771-171197793 TGGTGAGGATGTGGGGAAACTGG + Intronic
967099922 3:186207915-186207937 TTGTGGCCAACTGGGCCAACTGG - Intronic
967203326 3:187095133-187095155 TGGTGGACAAGTGGGGAAAGAGG - Intergenic
968455125 4:693746-693768 TTCAGGCCATGAGGGGAAATGGG + Intergenic
969920511 4:10534814-10534836 TTGTTGCTATTGGGGGAAACTGG - Intronic
971221143 4:24706986-24707008 ATGTAGCCATTGGGGGAAACTGG - Intergenic
972903521 4:43715450-43715472 GTGTGGCCCTGTGAGGAAACAGG + Intergenic
974527558 4:63062770-63062792 TTATGGCTAGGTGGAGAAACAGG + Intergenic
974738572 4:65974424-65974446 TTTTGAACATGTGGGGAAAGAGG - Intergenic
975613777 4:76226253-76226275 GTGTGGACATGGGGGTAAACAGG + Intronic
976635208 4:87280472-87280494 TTGTCACCATTTGGAGAAACTGG - Intergenic
978530966 4:109712895-109712917 TTGTGGCTAAGTGAGCAAACTGG - Exonic
978580473 4:110226794-110226816 CTGTGGCCTTGTGGGAATACAGG + Intergenic
984237579 4:177179294-177179316 ATGTGGCCAGGTGGGGAGAGAGG - Intergenic
984817098 4:183849105-183849127 TTAGGGCCAAGTGGGGAAATTGG + Intergenic
986349206 5:6861676-6861698 TGGTGAGCATGTGGGGAGACAGG - Intergenic
988030137 5:25753253-25753275 TTCAGGCCATGAGGGCAAACAGG - Intergenic
989439339 5:41451950-41451972 TTGTGTGCATGTTGAGAAACAGG + Intronic
989863043 5:46407194-46407216 TTGTGGCCTTCTTAGGAAACGGG + Intergenic
989909675 5:49614489-49614511 TTGTGGCCTTCTTTGGAAACGGG - Intergenic
990598741 5:57336284-57336306 TTCTTGCCATTTGGGGAAATAGG - Intergenic
993789016 5:92184006-92184028 TTGAGGCGATGAGGGGAAACTGG - Intergenic
996102762 5:119461440-119461462 TTGTGAGAATGTGGGGTAACAGG + Intronic
996778509 5:127159156-127159178 TTGTGGTCATTTGGGGGAAAAGG + Intergenic
996878371 5:128264742-128264764 TTCAGCCCATGTGGGGAAACAGG + Intronic
997373366 5:133377416-133377438 TTTTGGCCATGGGGCGAGACAGG + Intronic
997902031 5:137775582-137775604 TAGTGAAGATGTGGGGAAACTGG + Intergenic
1000657118 5:163892943-163892965 TTCAGGCCATGTTGGGAAGCGGG + Intergenic
1001157828 5:169288155-169288177 TTGAGGCCATGAGGAGATACAGG - Intronic
1002788293 6:420340-420362 TGGTGAGGATGTGGGGAAACTGG - Intergenic
1003257761 6:4489216-4489238 GGGTGGTCATGTGGGGACACAGG - Intergenic
1003567751 6:7234944-7234966 ATGTGGACATGTGGGAACACAGG - Intronic
1006584060 6:35094068-35094090 TGGAGGCCAGGTGGGGAAGCTGG + Intergenic
1006593975 6:35179301-35179323 TTTTGGCCCTGTGGGGACCCAGG - Intergenic
1008634544 6:53396616-53396638 TCATGGCCATGTTGGGAAAGAGG + Intergenic
1008893144 6:56519477-56519499 TTGAGACCATGTGGGGAGGCTGG + Intronic
1010073744 6:71775093-71775115 TGATGACCATGTGGGGCAACTGG - Intergenic
1010308189 6:74349540-74349562 TTCAGGCCATGTTGGGAAATGGG + Intergenic
1010978177 6:82340302-82340324 GTGTGGCCATGAGAAGAAACAGG - Intergenic
1011401593 6:86968445-86968467 TGGTGACAGTGTGGGGAAACAGG - Intronic
1013538887 6:111087976-111087998 TGGCGGCCATGTGGTGCAACGGG + Exonic
1013661608 6:112303366-112303388 TGGTGAAGATGTGGGGAAACTGG - Intergenic
1014096121 6:117464132-117464154 AGGAGGCCATGTGGGGAACCTGG - Intronic
1015913836 6:138194878-138194900 TTGAGGCCATTAAGGGAAACAGG + Intronic
1017463535 6:154673399-154673421 GTGGGGACATCTGGGGAAACTGG + Intergenic
1021111615 7:16700951-16700973 TTCTGGACATGTTGGGAAAGGGG - Intronic
1021130179 7:16902306-16902328 CTGAGGCCATTTGGGGAAACTGG - Intergenic
1021435563 7:20610568-20610590 TTGTGTGCATGTGGGGAAAGGGG + Intergenic
1021603202 7:22385113-22385135 TTATTCCCATGTGGAGAAACTGG - Intergenic
1025068400 7:55877463-55877485 TTGTGGCAAGGTGGTGAAACTGG + Intergenic
1025315233 7:58015691-58015713 TTGGGGCCTTGGGTGGAAACGGG + Intergenic
1025510597 7:61508829-61508851 TTGAAGCCTTCTGGGGAAACAGG + Intergenic
1025583545 7:62751301-62751323 TTGAGGCCATATGGGAAAAAAGG + Intergenic
1027845910 7:83374319-83374341 TGGTGAGCATGTGGGGAAACAGG + Intronic
1028077570 7:86534660-86534682 TTGGGGACATGTGTGGAAAGTGG + Intergenic
1028149150 7:87352113-87352135 TTCAGGCCATGAGGGGAAGCAGG - Intronic
1030475534 7:110028878-110028900 TTGTTGCCATTGGGGGAAATTGG - Intergenic
1031033465 7:116760854-116760876 TTGTGGCCATGTGTGGGGATTGG - Intronic
1031654385 7:124334358-124334380 TTTTGGCCATGTGAAGACACAGG - Intergenic
1031694609 7:124834602-124834624 TTGAGACAATGTGGAGAAACAGG + Intronic
1033123215 7:138684619-138684641 TTGTGGGAATGTGGAGAAAAAGG + Intronic
1034560557 7:151877046-151877068 CTGTGCCCAAGTGGGGAATCTGG + Exonic
1034876325 7:154727796-154727818 CTGTGCACATGTCGGGAAACAGG + Exonic
1035254009 7:157614673-157614695 GTGTGGCCATGTTTGGAGACAGG + Intronic
1035823935 8:2624263-2624285 TTGTGGAGATGTGGAGAAAAGGG + Intergenic
1038310915 8:26445645-26445667 CTGTGGGCAGGTGAGGAAACTGG - Intronic
1039501935 8:38024740-38024762 TTGGGGCCATGATGGGAAAGGGG + Intergenic
1040091897 8:43407678-43407700 TTGTGGCCATTTGGAGAAAAGGG + Intergenic
1040141409 8:43920711-43920733 TTGTGGCCAACGGTGGAAACGGG + Intergenic
1040141710 8:43925555-43925577 TTGTGGCCTTAGGTGGAAACGGG + Intergenic
1040141982 8:43930199-43930221 TTGTGGCCTTCGGTGGAAACGGG + Intergenic
1041117760 8:54556623-54556645 TGGTGGAGATGTGGGGAAACTGG + Intergenic
1041768722 8:61449345-61449367 TGGAGACCATGTGGGTAAACTGG - Intronic
1043544610 8:81301210-81301232 TTCTGGCCATGATGGGAAAAGGG - Intergenic
1044421777 8:92004970-92004992 TTGTGGCCATCTTGAGAATCTGG - Intronic
1047810384 8:128402455-128402477 TCGTGGCCATGGGAGGAAAATGG - Intergenic
1048288836 8:133164178-133164200 GTGTGGCCATTTGGGGACAGGGG - Intergenic
1049204072 8:141355229-141355251 CTGTGGCCATGTGGAGCAGCTGG - Intergenic
1049393742 8:142386239-142386261 GTGTGGCTATCTGGGGAAATGGG + Intronic
1050684726 9:8155180-8155202 TTGTGGCCATGTTGTGGAAGTGG - Intergenic
1050982206 9:12035015-12035037 TTGTGGCCACCTGGGTAATCCGG - Intergenic
1053181658 9:35976646-35976668 TGGTGGCCATTTGGGGAATGAGG - Intergenic
1056699743 9:88892330-88892352 ATGTGGCCATGTTTGGAAATAGG + Intergenic
1056729788 9:89155694-89155716 ATGTGACCAGGTGGAGAAACAGG - Intronic
1057495810 9:95560095-95560117 ATGAGGCCAAGTGAGGAAACGGG + Intergenic
1058449694 9:105084463-105084485 TTCAGGCCATGAGGGGAAATGGG + Intergenic
1058763564 9:108160219-108160241 ATGTGGCTTTGTGGGGAAAGGGG - Intergenic
1059208682 9:112490005-112490027 TTGTAGCCTGGTGGGGAAGCAGG + Intronic
1060066250 9:120503817-120503839 CCATGGCCATGTGAGGAAACCGG - Intronic
1060695162 9:125703108-125703130 TTGTTGCCATGTGAGGAAGTGGG - Intronic
1061409983 9:130415102-130415124 TGGAGGCCACGTGGGGAACCCGG + Intronic
1062253078 9:135608094-135608116 TTATGGCCATTTGGGGACATGGG - Intergenic
1186420918 X:9425479-9425501 TGGTGAGGATGTGGGGAAACTGG + Intergenic
1186475149 X:9851376-9851398 CTGTTGCCACGTGGGGAACCTGG - Intronic
1189045113 X:37582415-37582437 TGGAGAGCATGTGGGGAAACAGG - Intronic
1190425420 X:50330702-50330724 TTGGGGCCATGTTTGGAAAATGG - Intronic
1190551228 X:51583197-51583219 TTATGAGCATGTGGAGAAACTGG - Intergenic
1191569632 X:62594438-62594460 TTGTGGCCTTCGGTGGAAACGGG + Intergenic
1191569732 X:62595597-62595619 TTGAGGCCTTCTGTGGAAACGGG + Intergenic
1191569957 X:62600209-62600231 TTGAGGCCTTCTGTGGAAACGGG + Intergenic
1192209295 X:69117416-69117438 TTGTGGCCAGGAGAGGAAAATGG + Intergenic
1192718514 X:73668413-73668435 TTGTGGTCATTTGGAGGAACAGG + Intronic
1192813814 X:74571134-74571156 ATGTAGCCATTGGGGGAAACTGG + Intergenic
1193124996 X:77861406-77861428 TTGCGAGCATGTGGAGAAACTGG + Intronic
1195066316 X:101241369-101241391 ATGTTGTCATTTGGGGAAACTGG + Intronic
1195313548 X:103656549-103656571 TTCAGGCCATGATGGGAAACAGG - Intergenic
1195585049 X:106555504-106555526 TTGTGGGGATGTGGAGAAAAAGG + Intergenic
1195821497 X:108950002-108950024 TGGAGACCATGTGGGGAACCTGG - Intergenic
1195974141 X:110507534-110507556 TGGTGAACATGTGGGGTAACAGG + Intergenic
1195992594 X:110697371-110697393 ATGTTACCATTTGGGGAAACTGG + Intronic
1196643649 X:118092835-118092857 ATGTAGTCATTTGGGGAAACTGG + Intronic
1196908674 X:120464568-120464590 ATGTGACCATCTGGGGAAATAGG - Intronic
1198360643 X:135892392-135892414 TTGTGTGCATGTGGCGAATCTGG + Intronic
1199065564 X:143413128-143413150 TTGTGTGGATGTGGTGAAACGGG - Intergenic
1199900309 X:152166375-152166397 TTGTGGATATGTGGGGATATGGG - Exonic
1201060421 Y:10038984-10039006 TTGTGCCCAGGGAGGGAAACTGG + Intergenic