ID: 1087076193

View in Genome Browser
Species Human (GRCh38)
Location 11:94129015-94129037
Sequence CCCGGGCCGCGCGCGGCACT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 163}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087076193_1087076203 -2 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076203 11:94129036-94129058 GGGACTTGCACGGGCGTGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 38
1087076193_1087076201 -4 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076201 11:94129034-94129056 CGGGGACTTGCACGGGCGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1087076193_1087076204 1 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076204 11:94129039-94129061 ACTTGCACGGGCGTGCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1087076193_1087076205 10 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076205 11:94129048-94129070 GGCGTGCGGGGTGGAACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1087076193_1087076206 16 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076206 11:94129054-94129076 CGGGGTGGAACCGCAGGAAGCGG 0: 1
1: 0
2: 1
3: 14
4: 141
1087076193_1087076209 26 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076209 11:94129064-94129086 CCGCAGGAAGCGGAGCTCTCGGG 0: 1
1: 0
2: 0
3: 14
4: 100
1087076193_1087076207 25 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076207 11:94129063-94129085 ACCGCAGGAAGCGGAGCTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 125
1087076193_1087076202 -3 Left 1087076193 11:94129015-94129037 CCGAGTGCCGCGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 33
4: 163
Right 1087076202 11:94129035-94129057 GGGGACTTGCACGGGCGTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087076193 Original CRISPR CCCGGGCCGCGCGCGGCACT CGG (reversed) Exonic