ID: 1087076244

View in Genome Browser
Species Human (GRCh38)
Location 11:94129210-94129232
Sequence GCGAAAGCCGCGCGCCCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087076237_1087076244 22 Left 1087076237 11:94129165-94129187 CCGAGACACAAAGGCAGGCGGGA 0: 1
1: 0
2: 0
3: 13
4: 203
Right 1087076244 11:94129210-94129232 GCGAAAGCCGCGCGCCCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087076244 Original CRISPR GCGAAAGCCGCGCGCCCGGC CGG Exonic