ID: 1087076244 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:94129210-94129232 |
| Sequence | GCGAAAGCCGCGCGCCCGGC CGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 80 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 5, 4: 73} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087076237_1087076244 | 22 | Left | 1087076237 | 11:94129165-94129187 | CCGAGACACAAAGGCAGGCGGGA | 0: 1 1: 0 2: 0 3: 13 4: 203 |
||
| Right | 1087076244 | 11:94129210-94129232 | GCGAAAGCCGCGCGCCCGGCCGG | 0: 1 1: 0 2: 1 3: 5 4: 73 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087076244 | Original CRISPR | GCGAAAGCCGCGCGCCCGGC CGG | Exonic | ||