ID: 1087078358

View in Genome Browser
Species Human (GRCh38)
Location 11:94146578-94146600
Sequence GGGTCCTCAGGACAGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087078358_1087078361 -7 Left 1087078358 11:94146578-94146600 CCAGGGTGCTGTCCTGAGGACCC 0: 1
1: 0
2: 2
3: 37
4: 239
Right 1087078361 11:94146594-94146616 AGGACCCACAGCCCTTCCTCGGG 0: 1
1: 0
2: 2
3: 26
4: 333
1087078358_1087078370 24 Left 1087078358 11:94146578-94146600 CCAGGGTGCTGTCCTGAGGACCC 0: 1
1: 0
2: 2
3: 37
4: 239
Right 1087078370 11:94146625-94146647 CAGCAATGCAGAATCTGGATTGG 0: 1
1: 0
2: 0
3: 19
4: 188
1087078358_1087078360 -8 Left 1087078358 11:94146578-94146600 CCAGGGTGCTGTCCTGAGGACCC 0: 1
1: 0
2: 2
3: 37
4: 239
Right 1087078360 11:94146593-94146615 GAGGACCCACAGCCCTTCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 239
1087078358_1087078368 19 Left 1087078358 11:94146578-94146600 CCAGGGTGCTGTCCTGAGGACCC 0: 1
1: 0
2: 2
3: 37
4: 239
Right 1087078368 11:94146620-94146642 CCTGCCAGCAATGCAGAATCTGG 0: 1
1: 0
2: 2
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087078358 Original CRISPR GGGTCCTCAGGACAGCACCC TGG (reversed) Intronic