ID: 1087078766

View in Genome Browser
Species Human (GRCh38)
Location 11:94150361-94150383
Sequence CAGTTTAAACAGGTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087078758_1087078766 27 Left 1087078758 11:94150311-94150333 CCCCAGGAGTGGCAAGATAGAAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG 0: 1
1: 0
2: 2
3: 25
4: 260
1087078760_1087078766 25 Left 1087078760 11:94150313-94150335 CCAGGAGTGGCAAGATAGAACTG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG 0: 1
1: 0
2: 2
3: 25
4: 260
1087078759_1087078766 26 Left 1087078759 11:94150312-94150334 CCCAGGAGTGGCAAGATAGAACT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG 0: 1
1: 0
2: 2
3: 25
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087078766 Original CRISPR CAGTTTAAACAGGTGGAGAA GGG Intronic
901574213 1:10187013-10187035 CTGTTCAAAAAGGTGGAAAATGG + Intergenic
902659728 1:17892709-17892731 CAGCTTCCACAGGTGGAAAATGG + Intergenic
903292585 1:22324200-22324222 CAGTTTCCACATGTGTAGAATGG - Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
907769694 1:57448229-57448251 CAGTCTAAATAGGTGCACAAGGG + Intronic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
908842111 1:68290535-68290557 CAGTATAACCAGGTGGAAAGAGG - Intergenic
910071454 1:83219105-83219127 CAGTTGTAACAGGTGGAAAATGG - Intergenic
910416752 1:87009234-87009256 CAGTTTAAAGGGATGGAGAAAGG - Intronic
911381952 1:97126392-97126414 GAGTGTGAACAAGTGGAGAAAGG - Intronic
912196615 1:107404629-107404651 CAGATCCAACAGGTGCAGAAGGG + Intronic
915383367 1:155464827-155464849 CAATTTAAACAAGAGGGGAAAGG + Intronic
917937777 1:179885454-179885476 TATTTTAAAAAGCTGGAGAAGGG + Intronic
917968337 1:180192394-180192416 CACTTTAGAAAGGTGGAGGATGG + Intronic
918474785 1:184912534-184912556 CTGTTTCAACAGGTGAAAAATGG + Intronic
919261714 1:195204429-195204451 CAGTTTAATGGGGTGGAGGAAGG + Intergenic
921539711 1:216398808-216398830 CTGTTTCAACAAGTGGAGAATGG - Intronic
922255086 1:223886791-223886813 CAGAGTAAACAGGTGGAGATGGG - Intergenic
1065553083 10:26888579-26888601 CTGTTTAAATGGGTAGAGAAGGG - Intergenic
1067306472 10:45069383-45069405 CAGTTGTAGGAGGTGGAGAAAGG - Intergenic
1072273108 10:93796512-93796534 CAGTTTACTCATGTGGAAAAAGG + Intronic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1075282456 10:121151655-121151677 CAGAGTAAACAAGGGGAGAATGG - Intergenic
1075746854 10:124733995-124734017 GAGTTTAGACAGATGAAGAACGG - Intronic
1078298711 11:10102605-10102627 AAGTTTAAGCAGGTTGAAAAGGG + Intronic
1079296054 11:19235346-19235368 CACTTTAAAAAGGATGAGAAAGG + Intronic
1081036690 11:38156689-38156711 CATTTTAGACAGGTTGAAAATGG - Intergenic
1081750638 11:45508363-45508385 GAGTTTACACAGCTGGTGAATGG - Intergenic
1085219120 11:74858669-74858691 GAGTTTAATCAGGTGAAGAGGGG - Intronic
1085547389 11:77332528-77332550 GAGTTTTAACAGGCTGAGAAAGG + Intronic
1085935731 11:81139531-81139553 TACTTAAAACAGGTGGAAAAAGG - Intergenic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1087344496 11:96953971-96953993 AAATTTAAACAGTTGGAAAAAGG + Intergenic
1089320226 11:117620845-117620867 CAGTTTCCACAGGTGCAAAATGG + Intronic
1089560104 11:119339548-119339570 CAGTTTGATCTGGTGAAGAATGG - Exonic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1092053760 12:5492012-5492034 CAGTTTAAAGAAGAGGAGAAAGG - Intronic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1097917551 12:65036742-65036764 CAGTTTTAAAAGATGAAGAAGGG - Intergenic
1097922434 12:65090622-65090644 GAGGTTAAACAGGTGAAGGAGGG + Intronic
1098816314 12:75169019-75169041 CAGTTTAGACAGGTGCCAAAAGG + Intronic
1099029378 12:77506261-77506283 GAGTTTAAACAAGTGAACAATGG - Intergenic
1100815731 12:98385431-98385453 TAGTTTAAATAGGTGGAGAATGG - Intergenic
1103365771 12:120382057-120382079 AATTTTAAAAAGGTTGAGAAAGG + Intergenic
1104780567 12:131417364-131417386 CAGTTTCCACAGCTGTAGAATGG - Intergenic
1106487868 13:30188540-30188562 CAATTAAAACACTTGGAGAACGG + Intergenic
1107697655 13:43016157-43016179 ATATTTAAAAAGGTGGAGAAAGG + Intergenic
1108050436 13:46430387-46430409 AAGTTCAAACAAGTTGAGAAAGG - Intronic
1108263590 13:48681886-48681908 CAGTTTAAGAAGTTAGAGAAGGG - Intronic
1109543012 13:63804011-63804033 AAGTTCAAACAAGTTGAGAAAGG - Intergenic
1109754997 13:66745943-66745965 AATTTTAAACAGGTGGCGATAGG - Intronic
1110225690 13:73117319-73117341 CAGTCTAAAAAGTTTGAGAATGG + Intergenic
1110671711 13:78188275-78188297 CAGTTCATATAGTTGGAGAATGG - Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112048546 13:95622021-95622043 CAATTTCAAAAGGTGTAGAAGGG - Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1112686437 13:101833163-101833185 CTGTTTAGAAAGGTGCAGAATGG - Intronic
1113909457 13:113835231-113835253 CCGTCTATGCAGGTGGAGAAGGG + Intronic
1115167490 14:30465213-30465235 CAGTGCAAAAAGGTAGAGAAAGG - Intergenic
1115675926 14:35674215-35674237 GAATTAAAACTGGTGGAGAAGGG + Exonic
1117642142 14:57811212-57811234 AAGTTTAGAAAGGTGGGGAAAGG + Intronic
1118999632 14:70870686-70870708 CAGTTTGTACAGGTAGAGAGAGG + Intergenic
1120691057 14:87593484-87593506 CAGTTTTATCATCTGGAGAATGG + Intergenic
1120960153 14:90117195-90117217 CAGTGTATACAGCTGGACAAAGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122526363 14:102388052-102388074 TATTTTAAAGAGGTGCAGAAAGG + Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123664393 15:22597153-22597175 AAGTTTAAAAAGGTGCAAAATGG + Intergenic
1124318228 15:28691590-28691612 AAGTTTAAAAAGGTGCAAAATGG + Intergenic
1124565205 15:30805874-30805896 AAGTTTAAAAAGGTGCAAAATGG - Intergenic
1125768076 15:42148209-42148231 CAGTTTCAACATCTGGAAAATGG - Intronic
1126418946 15:48450822-48450844 CATTTTAAACAGATGCACAAAGG + Intronic
1128485692 15:68085315-68085337 CATTTTAAAGTGGTGGAAAATGG - Intronic
1129174990 15:73833411-73833433 GAGTTTCTACAGGTGGAGATGGG - Intergenic
1129553439 15:76478684-76478706 CATTTCAAACCAGTGGAGAAAGG - Intronic
1130136555 15:81186341-81186363 GAGTTTAACCAGGTGGTGAGTGG + Intronic
1131050769 15:89346433-89346455 CAGTTTGGACAGGTGGAGCCAGG - Intergenic
1131285119 15:91050595-91050617 CAGTTCCAACAGGCGGAGACTGG + Intergenic
1131540992 15:93275224-93275246 CAGTTTTCACATGTGTAGAATGG - Intergenic
1135704445 16:24662670-24662692 CAGTGCAAGCAGGTGGTGAAGGG + Intergenic
1135717565 16:24785058-24785080 CATTTTAAATCAGTGGAGAAAGG - Intronic
1135877493 16:26216704-26216726 CAGTTCCAGCAGGTAGAGAAGGG + Intergenic
1135972184 16:27080585-27080607 CAGCTTGAATAGGTTGAGAAAGG + Intergenic
1136600433 16:31283490-31283512 CAATTCAATCAAGTGGAGAAAGG - Intronic
1139395808 16:66638011-66638033 GACTTTCAGCAGGTGGAGAAAGG - Intronic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1144016378 17:11200294-11200316 CAGTTTATGCAGGTGTAAAAGGG + Intergenic
1144209620 17:13003363-13003385 AAGTTTAGGCAGGTGCAGAAGGG + Intronic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1146106248 17:30039847-30039869 CAGTTGTAGGAGGTGGAGAAGGG - Intronic
1146951449 17:36909382-36909404 CACTTTAAAATGGTGGAAAATGG + Intergenic
1147005376 17:37398931-37398953 CATTTTACATAGGAGGAGAAAGG + Intronic
1147120590 17:38333103-38333125 CAGTTTAGGCCAGTGGAGAAGGG + Intronic
1150411173 17:64941765-64941787 CAGGATAAAGGGGTGGAGAAAGG - Intergenic
1150716150 17:67574177-67574199 CAGTTGCCCCAGGTGGAGAATGG - Intronic
1151283196 17:73091883-73091905 CAGGTTTAAAAGGGGGAGAAAGG - Intronic
1153645686 18:7194242-7194264 CAGTGTGAATAGTTGGAGAAGGG - Intergenic
1154287729 18:13075770-13075792 CAGTTTACACATGTGCAAAATGG - Intronic
1155901519 18:31396713-31396735 CAATTTACCCAGGTGGTGAATGG + Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156973205 18:43183185-43183207 CATTTTAAAGAGCTGAAGAATGG - Intergenic
1157157425 18:45281574-45281596 CAGTTGAAATATGTTGAGAACGG + Intronic
1158339010 18:56445493-56445515 GACTTTAAAGAGGTGGAGGAGGG + Intergenic
1158474412 18:57767236-57767258 CAGACTAAGCAGGTGGGGAAGGG + Intronic
1159781079 18:72661420-72661442 CACTTTAAACAGGAAGTGAAGGG + Intergenic
1160548468 18:79678261-79678283 CAGTTTAAAGAGGTGAACACAGG - Intergenic
1160947181 19:1649058-1649080 CCGTTCACCCAGGTGGAGAATGG + Intronic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1163455991 19:17405963-17405985 CAGTTTCCCCAGGTGGAGACCGG - Intronic
1166552334 19:43674515-43674537 CAGTTTTCTCAGCTGGAGAAGGG + Intergenic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
1168656971 19:58137075-58137097 CAGTTTAAACATGTAAAAAATGG + Intronic
925662298 2:6215183-6215205 CAGTTCAAACAGGTAGAGAGTGG + Intergenic
925822816 2:7817094-7817116 CATTGTAAAGAGGTGGAGCATGG + Intergenic
926344060 2:11929667-11929689 CAGTTTCTACAGCTGTAGAAAGG + Intergenic
927583440 2:24276853-24276875 CAGTTTAATGAGCTGCAGAAAGG - Intronic
929968256 2:46551522-46551544 CAGTGTCAACATGTGGAGCAGGG + Intronic
930194046 2:48490916-48490938 AAGTTTAAAGATGTTGAGAATGG - Intronic
930548571 2:52801607-52801629 CACTTTAAACTGGTGGAAAAAGG - Intergenic
930924749 2:56803448-56803470 CAGTTTAAACAGACAGAGATAGG + Intergenic
931386971 2:61806451-61806473 CATTTTAAACACCTAGAGAAGGG + Intergenic
932062601 2:68522736-68522758 CAGTTCAAACTGATGGAGAAAGG + Intronic
932794743 2:74684599-74684621 AAGTTCAAGCAGATGGAGAAGGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934777548 2:96948999-96949021 AAGTTACAACAGGAGGAGAAAGG - Intronic
935044188 2:99465177-99465199 CAATTTAAACATGTGTAGGAGGG - Intronic
938224419 2:129603436-129603458 CAGTTTAATCACGAGAAGAATGG - Intergenic
938253072 2:129831270-129831292 CAGTTTAAAAAGGAGGAAAATGG - Intergenic
939556744 2:143684336-143684358 CAGTTTAGACAGGGGGTTAAGGG + Intronic
940294061 2:152104283-152104305 CAGGTTGAATAGGTGGAGCATGG + Intergenic
940620639 2:156108919-156108941 CGCTTTCAACAGGTAGAGAAAGG + Intergenic
940764612 2:157776547-157776569 CAGTTTAAACAGTAGGTAAATGG + Intronic
941356262 2:164496223-164496245 CAATTTAAACAAGTGGTGATGGG - Intronic
942553010 2:177140004-177140026 CAGTTTACCCAGGTACAGAAAGG - Intergenic
943420145 2:187659296-187659318 CAGTTTCCACAGGAAGAGAAGGG - Intergenic
943993045 2:194721710-194721732 CACTTGTAACAGGTGGAGCAGGG + Intergenic
944088239 2:195874312-195874334 CAGTTTAAGGAGATGGTGAAAGG + Intronic
944259183 2:197657523-197657545 CAGTTTAGAGATGTGAAGAAGGG - Intronic
944259233 2:197657964-197657986 CAGTTTAGAGATGTGAAGAAGGG + Intronic
946560767 2:220910208-220910230 CATTTTAACCAGCTGGAGCAGGG + Intergenic
946771059 2:223089468-223089490 GTGTTTAAATAGGTTGAGAATGG + Intronic
947163673 2:227240131-227240153 TGGTTTTAACAGGGGGAGAAGGG + Exonic
947417786 2:229916075-229916097 TACTGTAAACAAGTGGAGAAAGG + Intronic
1169572154 20:6918121-6918143 CAATTTAAAAATGTGGAGAAAGG + Intergenic
1169822141 20:9723207-9723229 AAGTTTGCACAGGTGAAGAATGG + Intronic
1170337456 20:15286005-15286027 CAGGTGAAAGAGGTGGAGATGGG - Intronic
1170759907 20:19240019-19240041 CAGTTTAACCAGGTAGAACATGG + Intronic
1173430186 20:42980972-42980994 GAGGTTAAAAAGTTGGAGAAAGG - Intronic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1174199855 20:48799671-48799693 CATTTTAGATAGGTGGAAAATGG + Intronic
1174699998 20:52598381-52598403 CAGTTTACACATTTGGTGAATGG - Intergenic
1175685867 20:61028523-61028545 CAGTTTCAACAAGTGGGGAAAGG + Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1179463805 21:41557327-41557349 CTGTTTTAAAAGGTGTAGAATGG + Intergenic
1181085048 22:20436094-20436116 CATTTTACAGAGGTGGAGACAGG + Intronic
1182111792 22:27728952-27728974 GAGTTTCAACAGCTGGAGAAAGG - Intergenic
1184005827 22:41707963-41707985 GAGTTCAAATATGTGGAGAAGGG - Intronic
1184398046 22:44256577-44256599 AATTTTAAACAGGTGGCCAAAGG - Intronic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
949928419 3:9059700-9059722 CAGCTTAAGCAAATGGAGAACGG - Intronic
950236507 3:11326245-11326267 AAGTGTAAAAAGGGGGAGAAGGG - Intronic
951351747 3:21614896-21614918 CAGTTTTATCAGGTGCAGATAGG + Intronic
952637768 3:35552481-35552503 CATGTTAAACAGATTGAGAAAGG + Intergenic
953890398 3:46748083-46748105 AAGATTAAGCGGGTGGAGAAGGG + Intronic
954054689 3:48012046-48012068 CAGGTTAAATAGGTGAAGGATGG - Intronic
955769633 3:62374319-62374341 CTCCTTAAACAGGTGGAGATGGG - Intronic
956170365 3:66428962-66428984 CTGTTTATTCAGGTGGAGACTGG + Intronic
957220164 3:77372119-77372141 GATTTTAAAAAGGGGGAGAAAGG + Intronic
959012165 3:101090266-101090288 CAGATAAAACAGGTGGAGAGAGG + Intergenic
960387433 3:117036898-117036920 GAGTTTAAATAGGTGGTGATAGG - Intronic
960713551 3:120554960-120554982 CAATTTAACCAGATGCAGAATGG + Intergenic
961399656 3:126629452-126629474 TAGGTTCAACAGTTGGAGAAAGG - Intronic
962153865 3:132923305-132923327 CAGGATAAACATGTGTAGAAGGG + Intergenic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962494434 3:135924900-135924922 CAGTTAAGGCAGGAGGAGAAAGG - Intergenic
962537629 3:136344506-136344528 CAGGTTATACATGTGGAGATGGG + Intronic
962940906 3:140124102-140124124 CAGTATGAACTGCTGGAGAAAGG + Intronic
963158282 3:142122777-142122799 GAGCCTAAGCAGGTGGAGAATGG + Intronic
963251340 3:143105870-143105892 CAGTTTGCACAGGGAGAGAAAGG - Intergenic
963341532 3:144040386-144040408 GAATTTTAATAGGTGGAGAAGGG - Intronic
967186231 3:186946982-186947004 GAGTTTTGATAGGTGGAGAATGG + Intronic
969145742 4:5122888-5122910 CAGCTGAAGTAGGTGGAGAAGGG - Intronic
969388702 4:6874613-6874635 CAGTACAGACAGGTGGTGAAAGG + Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970639466 4:18048314-18048336 CAGTTGAAACGGGCAGAGAATGG - Intergenic
975987365 4:80213796-80213818 AAGGTTACACAGCTGGAGAATGG - Intergenic
977994129 4:103482206-103482228 CAGTTTAAAAAGGTGCACAGTGG - Intergenic
979377023 4:119958774-119958796 CAGTTTAAAAAGGAGGAGCTGGG - Intergenic
979382410 4:120022655-120022677 CAGTTTAAAAAGGAGGAGCTGGG + Intergenic
980807622 4:137833811-137833833 TAGAATAAAAAGGTGGAGAAAGG - Intergenic
981143588 4:141299962-141299984 TAATTTTAAGAGGTGGAGAAAGG - Intergenic
983565941 4:169152151-169152173 CAGCTTACACAAGTGAAGAAAGG + Intronic
984028712 4:174576550-174576572 TAGTTTAAAGAGGTGGAGATTGG + Intergenic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
985534836 5:458379-458401 GAGTTTAAACAGGTGGATTTTGG + Intronic
985992873 5:3577919-3577941 CAGTTTGGACAGGTGGAGGCTGG - Intergenic
986012105 5:3725664-3725686 CAGTTTAAAACGGCGGAGAAAGG - Intergenic
986353882 5:6905464-6905486 CACTGGAGACAGGTGGAGAATGG - Intergenic
986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG + Intergenic
986731018 5:10635134-10635156 CACTTTGAACAGGTGGAAAGAGG - Intronic
988394856 5:30683719-30683741 CAATATAAACAGGTGGTCAATGG + Intergenic
990076655 5:51853569-51853591 CAGTGTAAAGGGGTGGAGATGGG + Intergenic
990311539 5:54543927-54543949 TACTTTAAAAAGGTGGGGAAGGG - Intronic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
994018573 5:94997550-94997572 CAATAAAAACAGGTGGACAAGGG - Intronic
994273095 5:97805389-97805411 AAGTTTAAACAAGTGGTGGAAGG - Intergenic
994275009 5:97824915-97824937 CATTTTAAACAGATGTTGAAGGG - Intergenic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
995885471 5:116889402-116889424 CAGATTTAACAGGTCTAGAATGG + Intergenic
996975380 5:129427072-129427094 CAGTTTACACAGGTGGGAAGTGG + Intergenic
997090444 5:130850371-130850393 TAATTTAAACAAGAGGAGAAAGG - Intergenic
997341456 5:133148134-133148156 CAGTCAAAACAGGCAGAGAAGGG - Intergenic
998488624 5:142526231-142526253 CATTTTAAACCAGTGGAGAAAGG + Intergenic
999753983 5:154650900-154650922 CAGTTTACAAAGGCGGAGACTGG + Intergenic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000550888 5:162662757-162662779 CTGTTTTAGCAGGTGTAGAATGG + Intergenic
1000799674 5:165709844-165709866 CTGTTTAAATAGGTGTAGAATGG - Intergenic
1001557166 5:172644670-172644692 CTCTTTAAAATGGTGGAGAATGG - Intronic
1002919584 6:1557406-1557428 CAGTGTACTCAGGTGGAAAATGG - Intergenic
1003199382 6:3945117-3945139 CTGCTTAGACAGGTGCAGAAAGG + Intergenic
1004653297 6:17633114-17633136 CAGTTCAAACATGTGGTTAAGGG - Intronic
1007147982 6:39656581-39656603 CAGGTTAAACAGCTAGAGAAAGG - Intronic
1007440758 6:41857743-41857765 AAGTCTAATCAGGTGGATAAAGG - Intronic
1007773301 6:44208442-44208464 GAGTATAAGAAGGTGGAGAAGGG - Intergenic
1008612467 6:53197081-53197103 CACTTTAAACAGAAGGAAAATGG - Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012242942 6:96895060-96895082 CATTTTAAGTAAGTGGAGAAAGG + Intronic
1012585134 6:100912885-100912907 CAATTCAATCAAGTGGAGAAAGG - Intergenic
1012900684 6:105002483-105002505 CAGTTTAAACAGCCGTAGATGGG - Intronic
1013464254 6:110403230-110403252 AAGTTAAAACATGTGGAAAAAGG - Intronic
1015813482 6:137184863-137184885 CAGTTTACACAGGGAGAGAGAGG + Intergenic
1016133434 6:140507011-140507033 CAATTTAAACTGCTAGAGAATGG - Intergenic
1016162001 6:140893996-140894018 CAGTTTACACAGGGAGAGAGAGG + Intergenic
1017504498 6:155055563-155055585 CAGTTTAAACATGTGCATTAAGG - Intronic
1017712947 6:157186250-157186272 CAGTTTAAAAAAGGGGAAAAGGG - Intronic
1018025908 6:159805524-159805546 CATTTTCAAGAGTTGGAGAAAGG + Intronic
1018297048 6:162359363-162359385 CATTTTACAGAGGTGGAAAATGG + Intronic
1020169495 7:5833969-5833991 CAGTGAAAACAGGAAGAGAATGG + Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1025106766 7:56177014-56177036 CAGTACAAAAAGGTAGAGAAAGG - Intergenic
1026252582 7:68683933-68683955 CAGTTTGAAAAGGTCAAGAATGG + Intergenic
1027289163 7:76684056-76684078 CAGTTGTAACAGGTGGAAAATGG - Intergenic
1028474155 7:91235498-91235520 CTGTTTAAAAAAGTGGATAAGGG - Intergenic
1028620815 7:92826451-92826473 GAATTTCAACAGGTGGAGAGTGG + Intronic
1028948581 7:96608441-96608463 CACTTTAAACAGGTGAATTATGG - Intronic
1030188497 7:106787740-106787762 CAGCTCAAAAAGGTGGAGAGGGG + Intergenic
1032319133 7:130868737-130868759 CTGTTTTAACAGCTGTAGAATGG + Intergenic
1032739980 7:134729398-134729420 CAGATTAAACAGGTAGACATCGG - Intergenic
1033326148 7:140379944-140379966 AACTTTAAATAGGTGGAAAAGGG + Intronic
1036156722 8:6348901-6348923 TAGTTTCAACAGTAGGAGAAAGG + Intergenic
1037839719 8:22235314-22235336 CATTTTAAAAAGGTGGAGGGTGG + Intergenic
1039901610 8:41756751-41756773 CATTTTAAACAGGGGCAGGATGG + Intronic
1043107747 8:76136266-76136288 CTGCTTAAAAAAGTGGAGAATGG - Intergenic
1045573372 8:103392987-103393009 GAGTTCAAACACGTGTAGAAAGG + Intergenic
1047759346 8:127942544-127942566 CAGTTTCAGCAGCTGTAGAATGG - Intergenic
1048893297 8:138966659-138966681 CAGTTTTTAAAGGGGGAGAAGGG + Intergenic
1050016111 9:1236200-1236222 CACTTTCAACAGCTGGAGGATGG - Intergenic
1050135511 9:2459469-2459491 CAATTTAAAAAGGTGGAGGAGGG + Intergenic
1050265199 9:3882505-3882527 CACTAGAAACAGGTGGTGAAGGG + Intronic
1052073857 9:24116959-24116981 CAGAATAAAAATGTGGAGAAGGG - Intergenic
1052529588 9:29664335-29664357 AGATTTGAACAGGTGGAGAAAGG + Intergenic
1057686942 9:97243248-97243270 AAGGTTAAACAAGTGGAGAGAGG + Intergenic
1058051035 9:100406829-100406851 TAGTATAAAGAGGTGGAGAAAGG + Intergenic
1058493107 9:105523595-105523617 GAATTAAAACTGGTGGAGAAGGG - Intronic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059618293 9:115975233-115975255 CAATTTACACAGGAGAAGAAAGG - Intergenic
1060425762 9:123504192-123504214 CAGTTTCACCAGATGGCGAAGGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1185944186 X:4356122-4356144 TAGATCAAAAAGGTGGAGAAAGG + Intergenic
1187130171 X:16494876-16494898 CAATTTAAATAGTTGGAGAATGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188062028 X:25612710-25612732 GAGTTTAGTCAGTTGGAGAATGG - Intergenic
1191937457 X:66440646-66440668 AAGTTTTACCAGGTGGAGATTGG + Intergenic
1192312475 X:70028114-70028136 CAGTTTCAAACGGTGGAGATGGG + Intronic
1194810074 X:98378643-98378665 CAGTTCAAACAAGTGGTGGAAGG - Intergenic
1196405375 X:115356606-115356628 CAGTTTCAACAGCTTCAGAAAGG - Intergenic
1196917631 X:120554910-120554932 AAGTTCAAACAGGAGGATAAAGG - Intronic
1198184484 X:134240055-134240077 CAGTGAAAAAGGGTGGAGAATGG + Intronic
1199254914 X:145708737-145708759 CAGTATAAAAAGGTGGGGGAAGG + Intergenic
1199901516 X:152177217-152177239 CAGTTAAAACAGGAGGTGGACGG + Intronic
1200836463 Y:7737134-7737156 GAGTATAAACAGTTTGAGAAGGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201730710 Y:17199776-17199798 TAGAATAAAAAGGTGGAGAAAGG + Intergenic