ID: 1087088369

View in Genome Browser
Species Human (GRCh38)
Location 11:94242798-94242820
Sequence GACATGAGGAAAAAGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087088369_1087088373 12 Left 1087088369 11:94242798-94242820 CCCAGGATCTTTTTCCTCATGTC No data
Right 1087088373 11:94242833-94242855 CAAAAAGCTGAACATAAAAATGG No data
1087088369_1087088374 19 Left 1087088369 11:94242798-94242820 CCCAGGATCTTTTTCCTCATGTC No data
Right 1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087088369 Original CRISPR GACATGAGGAAAAAGATCCT GGG (reversed) Intergenic
No off target data available for this crispr