ID: 1087088374

View in Genome Browser
Species Human (GRCh38)
Location 11:94242840-94242862
Sequence CTGAACATAAAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087088369_1087088374 19 Left 1087088369 11:94242798-94242820 CCCAGGATCTTTTTCCTCATGTC No data
Right 1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG No data
1087088371_1087088374 5 Left 1087088371 11:94242812-94242834 CCTCATGTCTTTGAAAACAACCA No data
Right 1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG No data
1087088370_1087088374 18 Left 1087088370 11:94242799-94242821 CCAGGATCTTTTTCCTCATGTCT No data
Right 1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087088374 Original CRISPR CTGAACATAAAAATGGACAA TGG Intergenic
No off target data available for this crispr