ID: 1087090371

View in Genome Browser
Species Human (GRCh38)
Location 11:94264861-94264883
Sequence AAGTGGGACCCTATCTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087090371_1087090373 -8 Left 1087090371 11:94264861-94264883 CCTAAAGAGATAGGGTCCCACTT No data
Right 1087090373 11:94264876-94264898 TCCCACTTTGTCATCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087090371 Original CRISPR AAGTGGGACCCTATCTCTTT AGG (reversed) Intergenic
No off target data available for this crispr