ID: 1087091162

View in Genome Browser
Species Human (GRCh38)
Location 11:94274569-94274591
Sequence CTCCAGCAGCAGAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087091162_1087091165 3 Left 1087091162 11:94274569-94274591 CCTCTCTCCTTCTGCTGCTGGAG No data
Right 1087091165 11:94274595-94274617 CTTCCAAATATGATACCATGTGG No data
1087091162_1087091166 4 Left 1087091162 11:94274569-94274591 CCTCTCTCCTTCTGCTGCTGGAG No data
Right 1087091166 11:94274596-94274618 TTCCAAATATGATACCATGTGGG No data
1087091162_1087091171 30 Left 1087091162 11:94274569-94274591 CCTCTCTCCTTCTGCTGCTGGAG No data
Right 1087091171 11:94274622-94274644 CCCCTGTTTCCTTCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087091162 Original CRISPR CTCCAGCAGCAGAAGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr