ID: 1087095230

View in Genome Browser
Species Human (GRCh38)
Location 11:94311754-94311776
Sequence CTGAATCTACAAATGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087095230_1087095232 -7 Left 1087095230 11:94311754-94311776 CCATTGTTCATTTGTAGATTCAG No data
Right 1087095232 11:94311770-94311792 GATTCAGTCTTTCAATCCCAGGG No data
1087095230_1087095234 6 Left 1087095230 11:94311754-94311776 CCATTGTTCATTTGTAGATTCAG No data
Right 1087095234 11:94311783-94311805 AATCCCAGGGATAAAAATTAGGG No data
1087095230_1087095231 -8 Left 1087095230 11:94311754-94311776 CCATTGTTCATTTGTAGATTCAG No data
Right 1087095231 11:94311769-94311791 AGATTCAGTCTTTCAATCCCAGG No data
1087095230_1087095233 5 Left 1087095230 11:94311754-94311776 CCATTGTTCATTTGTAGATTCAG No data
Right 1087095233 11:94311782-94311804 CAATCCCAGGGATAAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087095230 Original CRISPR CTGAATCTACAAATGAACAA TGG (reversed) Intergenic
No off target data available for this crispr