ID: 1087096743

View in Genome Browser
Species Human (GRCh38)
Location 11:94326330-94326352
Sequence CTGAATATATAAGTGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087096743_1087096746 14 Left 1087096743 11:94326330-94326352 CCATTGTCCACTTATATATTCAG No data
Right 1087096746 11:94326367-94326389 CTGTGCTTCAACATCATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087096743 Original CRISPR CTGAATATATAAGTGGACAA TGG (reversed) Intergenic
No off target data available for this crispr