ID: 1087100298

View in Genome Browser
Species Human (GRCh38)
Location 11:94357271-94357293
Sequence CCTGGGGTCTCTCTAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087100288_1087100298 22 Left 1087100288 11:94357226-94357248 CCAGATTTTTCAACCTTTGGACT No data
Right 1087100298 11:94357271-94357293 CCTGGGGTCTCTCTAGCTTTTGG No data
1087100291_1087100298 9 Left 1087100291 11:94357239-94357261 CCTTTGGACTCTGGGACTTGCAC 0: 53
1: 117
2: 181
3: 275
4: 408
Right 1087100298 11:94357271-94357293 CCTGGGGTCTCTCTAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087100298 Original CRISPR CCTGGGGTCTCTCTAGCTTT TGG Intergenic
No off target data available for this crispr