ID: 1087102204

View in Genome Browser
Species Human (GRCh38)
Location 11:94376574-94376596
Sequence TGCACAGCTAAACTGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087102204_1087102207 -9 Left 1087102204 11:94376574-94376596 CCTTTTCCCAGTTTAGCTGTGCA No data
Right 1087102207 11:94376588-94376610 AGCTGTGCATGACCTTTAGCAGG No data
1087102204_1087102209 4 Left 1087102204 11:94376574-94376596 CCTTTTCCCAGTTTAGCTGTGCA No data
Right 1087102209 11:94376601-94376623 CTTTAGCAGGCTGCCTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087102204 Original CRISPR TGCACAGCTAAACTGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr