ID: 1087104185

View in Genome Browser
Species Human (GRCh38)
Location 11:94394082-94394104
Sequence GGACTGGGGAGGGGTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 1, 2: 6, 3: 83, 4: 704}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087104171_1087104185 17 Left 1087104171 11:94394042-94394064 CCCGCTGGTCATACTCAGGCTGA 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG 0: 1
1: 1
2: 6
3: 83
4: 704
1087104176_1087104185 -7 Left 1087104176 11:94394066-94394088 CCAGGGTCCAGTGAGAGGACTGG 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG 0: 1
1: 1
2: 6
3: 83
4: 704
1087104170_1087104185 18 Left 1087104170 11:94394041-94394063 CCCCGCTGGTCATACTCAGGCTG 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG 0: 1
1: 1
2: 6
3: 83
4: 704
1087104172_1087104185 16 Left 1087104172 11:94394043-94394065 CCGCTGGTCATACTCAGGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG 0: 1
1: 1
2: 6
3: 83
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087104185 Original CRISPR GGACTGGGGAGGGGTCCAGG AGG Intronic
900110850 1:1004970-1004992 GGACCGTGGAGGGGTGCAGTTGG - Intergenic
900297664 1:1960117-1960139 GGGATGGGGAGGAGGCCAGGAGG - Intronic
900505035 1:3025658-3025680 GGAGTGGAGAAGGGTCTAGGAGG - Intergenic
900638387 1:3676490-3676512 GGACAGGGCAGGGGGACAGGGGG + Intronic
900671360 1:3856965-3856987 GGCCCGGGGAGGCGGCCAGGCGG + Exonic
900890698 1:5447755-5447777 GGACAGGACAGGGGTGCAGGTGG + Intergenic
901215213 1:7551137-7551159 AGACTGGGGTGGAGACCAGGAGG - Intronic
901664993 1:10820775-10820797 GGGCTGGGGACGGGGCCTGGGGG + Intergenic
901670975 1:10856267-10856289 GGACAGGGGAGGGGGGCGGGGGG + Intergenic
901790761 1:11652748-11652770 GCACTGGGGAAGGGGACAGGTGG + Intronic
902240901 1:15088711-15088733 GGGCTTGGGAGGAGTCTAGGGGG - Intronic
902574641 1:17369781-17369803 TGACTGGGGAGGGGTCGCTGAGG - Intergenic
902643090 1:17779212-17779234 GGGAGGGAGAGGGGTCCAGGAGG - Intronic
902727015 1:18343956-18343978 GGACTGGTGAGGGTTCCCAGAGG + Intronic
902809280 1:18879244-18879266 GGCCAGGGGAGGGGTCCCTGGGG + Intronic
903179483 1:21598062-21598084 GGCCTGGGGAGGGGGGCAGGAGG + Exonic
903224492 1:21887095-21887117 GGACTGGGGAGGGGGGAAAGCGG + Intronic
903348190 1:22701214-22701236 GGACTGGCCAGGGGCCCAGGTGG + Intergenic
903672749 1:25046181-25046203 GGCCTGGGGTGGGGCCCGGGAGG + Intergenic
903845873 1:26279821-26279843 AGACTGGGGAGGGGCCTGGGTGG - Exonic
904445774 1:30571957-30571979 GAACTGGGGAGGGTCCCAAGAGG - Intergenic
904688365 1:32276070-32276092 GCACGGGGGAGGGGTCCCGTCGG - Intronic
904753414 1:32754918-32754940 GGACGGGGGAGGGGGGGAGGCGG - Intronic
904965499 1:34369473-34369495 AGCCTGGGGAGGGGTGAAGGTGG + Intergenic
905012287 1:34755593-34755615 GGACGGGGGATGGGTGGAGGTGG - Intronic
905105185 1:35559606-35559628 TGGCTGGGGAGGGGTCCTAGGGG + Intronic
905227198 1:36486967-36486989 GGGCCGGGGCGGGGTCCAGGTGG + Intergenic
905442782 1:38005563-38005585 GGCCGGGGGCGGGGTCCGGGCGG - Intronic
905462196 1:38129197-38129219 GGCCTGGGGAGGGGTCCCCCAGG - Intergenic
905772816 1:40649428-40649450 GGACTGGGCAGGGGCCCAATGGG - Intronic
905790765 1:40788043-40788065 GGAATGGGGAGGGGAGGAGGTGG + Intronic
906057087 1:42925700-42925722 TGTGTGGGGAGGGGTGCAGGAGG + Exonic
906078316 1:43068136-43068158 CGACTGGGGAAGGGAGCAGGAGG + Intergenic
906164458 1:43675595-43675617 GGACTGGAGAGGGCCTCAGGTGG + Intronic
906209098 1:44002464-44002486 GGGCTGGGGAGGGGCCAGGGAGG - Intronic
906641651 1:47444497-47444519 GGCCTGGGGAGGCGTTCAGGAGG + Intergenic
906702058 1:47866759-47866781 GGGATGGAGAGGGGTCCAAGGGG - Intronic
906795565 1:48693869-48693891 GTACTGGGCAGGGCTCCAGGGGG + Intronic
909931593 1:81504273-81504295 GGACTGGGGAGGGCTGAAGAGGG - Intronic
910462585 1:87464417-87464439 GGACTGGGGAGGGGGGCTGCGGG + Intergenic
912321434 1:108717314-108717336 GGAATGGAGATGGGTCCAGCTGG + Intronic
912416351 1:109510341-109510363 GGAGTGGGGAGAGGTGCATGAGG - Intergenic
914331124 1:146671562-146671584 AGACTGGGGAGGGTACCAGCAGG + Intergenic
914754656 1:150556096-150556118 GGACCGGGGTGGGGTTGAGGTGG + Intronic
914825951 1:151138171-151138193 GGCCTAGGTAGGGGTGCAGGAGG - Intronic
914913721 1:151805587-151805609 TGACAGGGGAGGGAGCCAGGAGG + Exonic
915589886 1:156864708-156864730 GTGCTGGGGAGGGGTGCAGGAGG - Exonic
916498892 1:165369649-165369671 GGACTGTGGTGGGGTCCAGCAGG - Intergenic
916853473 1:168726993-168727015 GGACTGTGGAGGGGCTCAGCCGG - Intronic
917199178 1:172497480-172497502 GAATTGGGGAGGCATCCAGGAGG - Intergenic
917448101 1:175123730-175123752 GGGCTGGGGAGGGGAGCAGGAGG + Intronic
917729352 1:177858659-177858681 GGACTGTGGAGGGATACAGCTGG + Intergenic
917980587 1:180266610-180266632 GGCCTGGAGAGGGGACCATGCGG - Intronic
919465852 1:197921184-197921206 GGACCTGGGAGGGTTCCAGGGGG - Intronic
920190929 1:204193311-204193333 TGACTGGGGAGGGGTGAAGTAGG + Intronic
920401085 1:205676772-205676794 GGGCTGGGGAGGGGGGCAGCTGG - Intronic
920747010 1:208638387-208638409 GGACTGGGTTGGAATCCAGGTGG - Intergenic
921729877 1:218566045-218566067 GGGCTTGGGTGAGGTCCAGGTGG - Intergenic
922534563 1:226370389-226370411 GGCCAGAGGAGGGTTCCAGGAGG + Intronic
922695498 1:227728998-227729020 GGTGGGGCGAGGGGTCCAGGCGG + Intronic
923684091 1:236142260-236142282 GGGATGGGGAGGGGGCCGGGAGG + Intergenic
1062774846 10:135942-135964 GGACTGCGCACGGGCCCAGGAGG - Intronic
1062885157 10:1010818-1010840 GGACAGGGAAGAGGTGCAGGAGG - Intronic
1064183334 10:13139068-13139090 GGACTGGGGAGGGGAGAATGGGG - Intergenic
1065583962 10:27199672-27199694 GGAGTGGGGAGGGTCTCAGGAGG - Intronic
1066022648 10:31319143-31319165 GGAGGGGGGAGGGGTGGAGGCGG + Intronic
1066323289 10:34327395-34327417 AGACTGGGGTGGGATCCATGTGG - Intronic
1069103119 10:64348481-64348503 GGATTGAGGAAGGATCCAGGAGG - Intergenic
1069274044 10:66567082-66567104 GGAGTGGGGAGGGGTTTAGGTGG + Intronic
1069706165 10:70460135-70460157 GGACTGAGCAGGGGCCCAGACGG - Intergenic
1069782094 10:70963258-70963280 GGGGTGGGGAGGGGACCACGGGG + Intergenic
1069790313 10:71015094-71015116 CCACTGGGGTGGGGTTCAGGTGG - Intergenic
1069877304 10:71571014-71571036 GGACTGCGGAGGAGCCAAGGAGG - Intronic
1069958812 10:72067821-72067843 AGGCTGGGCAGGGGTCCGGGAGG + Intronic
1070529662 10:77325611-77325633 GGAATGGGGATGGGCCCAGTGGG - Intronic
1070589481 10:77791656-77791678 GGGCTGCAGTGGGGTCCAGGTGG - Exonic
1070656908 10:78277938-78277960 GGAGTGGAGAAGGCTCCAGGAGG + Intergenic
1071283731 10:84125560-84125582 GGGGTGGGGAGGGGGCGAGGAGG - Intergenic
1071502835 10:86215675-86215697 GGGCTGAGGAGGAGCCCAGGAGG - Intronic
1071521156 10:86332212-86332234 GGATTCTGGAGGGGTCAAGGAGG - Intronic
1071602240 10:86964034-86964056 GGACTGGGCAGAAGCCCAGGTGG + Intronic
1072474975 10:95751356-95751378 GATGTGGGGAGGGGTCTAGGAGG + Intronic
1072783282 10:98264526-98264548 GGCCAGGGGAGGGTTTCAGGCGG + Intronic
1073135621 10:101218521-101218543 GGCCTGGCTAGGGGACCAGGAGG + Intergenic
1073178159 10:101569120-101569142 GGCCTGGGGAGGGAGCCCGGTGG + Intergenic
1073291549 10:102415817-102415839 GGACTGGGCAGGGCACCTGGAGG - Intronic
1073326432 10:102646189-102646211 GGACTGGGGAGGGACCTAGGAGG - Intronic
1073329009 10:102658785-102658807 GGCCTTGGGAGGGGTGGAGGTGG + Intergenic
1073480759 10:103784809-103784831 GATGTGGGGAGGGGTCCAGATGG + Intronic
1073503877 10:103967179-103967201 GGGCTGGGGAGGGAGACAGGCGG + Exonic
1074101342 10:110356968-110356990 GGACTGGAGAGGGGCCGAGGGGG + Intergenic
1074440485 10:113473410-113473432 GGGCTGGGGAGGGGTTCAGAGGG + Intergenic
1075598461 10:123749441-123749463 GGACTAGGGAGGGGGCAGGGAGG - Intronic
1076108248 10:127841678-127841700 GGAGTGGGGAAGCATCCAGGTGG - Intergenic
1076116367 10:127904546-127904568 GGAGTGGTGAGGTGTTCAGGAGG + Intergenic
1076184209 10:128433914-128433936 GGTCTGGGGTGGGGCCGAGGGGG + Intergenic
1076217799 10:128710397-128710419 GGACAGGGGTGGGGCCCAAGTGG - Intergenic
1076228429 10:128799788-128799810 GAACTGGGGAGGGGTAGAGCAGG + Intergenic
1076314851 10:129532865-129532887 GGACTGGGGAGTGCCCCATGTGG - Intronic
1076516924 10:131051000-131051022 GGACTGGGGAGAGTCCCTGGGGG + Intergenic
1076732392 10:132445202-132445224 GGACTGGGAAGGGAGGCAGGAGG + Exonic
1076829218 10:132985841-132985863 AGACAGGGTGGGGGTCCAGGGGG + Intergenic
1076829279 10:132985989-132986011 GGGCTCGGGGAGGGTCCAGGTGG + Intergenic
1076854550 10:133109425-133109447 GGTCTGGGGAGTGGTCGTGGGGG - Intronic
1076917804 10:133433185-133433207 GGACTGGGGCGGGGTGGACGGGG - Intergenic
1077112979 11:870039-870061 GCACTGGCCTGGGGTCCAGGCGG - Intronic
1077350397 11:2090557-2090579 GGCCTGTGGAGGGGGCCGGGGGG - Intergenic
1077360639 11:2138953-2138975 GGCCTCGGGAGGGGGACAGGCGG + Intronic
1077369779 11:2176044-2176066 GTGCTGGGGAGGAGCCCAGGAGG + Intergenic
1077374295 11:2198339-2198361 GGACAGAGGAGGGGGCCAGTGGG + Intergenic
1078436919 11:11332933-11332955 AGACTGGGGAAGGGACCATGTGG + Intronic
1078926571 11:15880699-15880721 GGAGCTGGGATGGGTCCAGGGGG - Intergenic
1079407701 11:20160241-20160263 GGACTGGGGCAGCGTCAAGGTGG + Exonic
1079971590 11:27041835-27041857 AGACTGGGGATGGGGCAAGGAGG + Intronic
1080393639 11:31870978-31871000 GCTCTGGGGAGAGGGCCAGGGGG - Intronic
1080878961 11:36301434-36301456 GGAATGGGGAGGGGTTAAGCTGG + Intronic
1081383007 11:42438953-42438975 GGACGGGGCAGGGCTCCAGGTGG + Intergenic
1081553571 11:44136739-44136761 GGACTGGAGAGGGGAGGAGGAGG - Intronic
1081860588 11:46331449-46331471 GTATTGGGGAGGGGTTCATGGGG + Intergenic
1081863073 11:46345351-46345373 TGACGGGGGTGGGGTCGAGGGGG - Intronic
1082798328 11:57394866-57394888 GGTGTGGGGAGGGATGCAGGTGG - Intronic
1083184172 11:61007938-61007960 GGCCTGGGGAGTGGGGCAGGTGG - Intronic
1083214002 11:61207251-61207273 GGTCTGGGGAGGTCTCCAGGAGG + Intronic
1083216886 11:61226080-61226102 GGTCTGGGGAGGTCTCCAGGAGG + Intronic
1083219768 11:61244906-61244928 GGTCTGGGGAGGTCTCCAGGAGG + Intronic
1083445462 11:62705571-62705593 GGCCAGGGGTGGCGTCCAGGTGG - Exonic
1083471943 11:62889842-62889864 GGCCTGGGGCGGGGTCTGGGAGG + Intergenic
1083802206 11:65053239-65053261 GGACACGGGAGAGCTCCAGGAGG + Exonic
1084035827 11:66509732-66509754 GGCCTGGGGAGGGGGCAAGGAGG + Intronic
1084145410 11:67262612-67262634 GGTCAGGGGAGGGGTCGGGGAGG - Intergenic
1085269914 11:75264152-75264174 GGTCTGGGGAGGGGTCCCTTGGG + Intergenic
1085478659 11:76804441-76804463 GGACTGGGGAGGGGTCCGGGAGG - Intergenic
1085647932 11:78240045-78240067 GGAGTGGGGAGAGGGGCAGGTGG - Intronic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1087113131 11:94493570-94493592 GGGCAGGGGAGGGGTCCTGGCGG - Intronic
1089134307 11:116237102-116237124 GGACTGGGCAGAGTTCCAGGTGG + Intergenic
1089136823 11:116255827-116255849 GGTCGGGGGAGGGGGGCAGGAGG + Intergenic
1089328355 11:117672970-117672992 GGTCTGGGGAGGCTTCCTGGAGG - Intronic
1089354262 11:117839705-117839727 GGCCTGGACAGGGGTTCAGGCGG - Intronic
1089461384 11:118656247-118656269 GGACTGGGGTGGGCACCAGAGGG - Intronic
1089560241 11:119340036-119340058 GAGCGGGGGAGGGGCCCAGGCGG - Intronic
1089603087 11:119626951-119626973 GGCCTGGGGATGGGGCCAGGGGG + Intronic
1089763456 11:120745845-120745867 GGACTTGAGAGGTGTTCAGGAGG + Intronic
1090406463 11:126478438-126478460 GGAGTGGGGATGGGGCCGGGGGG + Intronic
1090743733 11:129690862-129690884 GAACTGGGCAGGGGGCCGGGTGG + Intergenic
1091227547 11:133966539-133966561 GGACTGAGGAGGGGCCAGGGTGG + Intergenic
1091328722 11:134713632-134713654 GCACTGGGCAGGAGTCCAGTTGG - Intergenic
1091434817 12:464088-464110 GTCCTGGGGAGGGGTCCGGGTGG + Intronic
1091463266 12:662095-662117 GGTCAGGGGAGGGCTCCTGGGGG + Intronic
1091618565 12:2068279-2068301 GGACTGGGGCAGGGTCTGGGGGG - Intronic
1091667726 12:2431208-2431230 GGTCTGGAGTGGGGGCCAGGAGG + Intronic
1092070070 12:5624921-5624943 GGGCTGGGGAGAGCTCTAGGGGG + Intronic
1092217776 12:6694887-6694909 GGGCTGGGGAGTGTTCCGGGTGG + Exonic
1092276654 12:7066642-7066664 GGACTGGGGAGAAGCCAAGGTGG - Intronic
1092680452 12:10974257-10974279 AGACTGGGGTGGGGTGCAGGTGG - Intronic
1092879571 12:12877553-12877575 GAACTGGGGAGGAGAGCAGGAGG + Intergenic
1092963045 12:13614557-13614579 GGTATGGGGAGGGGTGCAGTGGG + Intronic
1093149712 12:15606420-15606442 GGACTGCTGAGGGGCCCAGATGG - Intergenic
1094385472 12:29888930-29888952 GGGCTGGGGGGGGTTCCGGGTGG - Intergenic
1095946217 12:47755050-47755072 GGACAGGGGAAGGGTGCATGGGG + Intronic
1095950336 12:47778266-47778288 GGGGTGGGGAGCGGTGCAGGTGG + Intronic
1096073362 12:48788189-48788211 GGACTGGGGATGGGAGAAGGCGG - Intronic
1096241585 12:49962683-49962705 GGAGAGGTGAGGGGCCCAGGAGG - Intronic
1096627322 12:52903839-52903861 GGGCTGGGGTGGGGTGGAGGAGG - Intronic
1096980972 12:55728252-55728274 TGAGTGGCGAGGGGTCCTGGGGG - Intronic
1097155912 12:57012325-57012347 GGACTGGGGAGGGGGCTGTGGGG - Intronic
1097182061 12:57177400-57177422 GGAGTGGGGAGGGGTCAGGAGGG - Intronic
1097189170 12:57211380-57211402 GGACAGGGCAGGGGCCCAGCTGG - Intronic
1097233659 12:57526305-57526327 GGGCTGGGGAGGGCTCCCTGAGG - Exonic
1097263179 12:57731039-57731061 GGACTGGGGAGGGGTCTTGGGGG + Intronic
1097266096 12:57745655-57745677 GGACTTGGGAGCGGGGCAGGGGG - Intronic
1099596351 12:84671661-84671683 GGACTAGAGTGGGGTGCAGGAGG - Intergenic
1099866696 12:88291533-88291555 GGACTGGGGAAGGTTTCAGAGGG - Intergenic
1102063314 12:109951977-109951999 GGACTGGGCAGGAGGCCAGGCGG + Intronic
1102497471 12:113329568-113329590 GAGCTGGGGAGGGGTCCTGAGGG - Intronic
1102511856 12:113421342-113421364 GGGCTGGGGAGGCTTCCTGGAGG - Intronic
1103156424 12:118689001-118689023 AGGCTGGGGAGGTGGCCAGGTGG + Intergenic
1103556634 12:121770589-121770611 GTGCTGGGGAGAGGACCAGGTGG + Intronic
1103939627 12:124494766-124494788 GGATTGGGGTGGCTTCCAGGGGG - Intronic
1104596847 12:130125952-130125974 GGGCTGGGAAAGGGACCAGGAGG + Intergenic
1104849198 12:131863241-131863263 GGTCGGGGGAGGGGTGAAGGGGG + Intergenic
1105295675 13:19086341-19086363 GGACTGGGGCGGGGGCGGGGAGG - Intergenic
1105700670 13:22933495-22933517 GGAGCGGGGATGGGTGCAGGTGG - Intergenic
1105853465 13:24355650-24355672 GGAGCGGGGATGGGTGCAGGTGG - Intergenic
1106135332 13:26969069-26969091 GGCCTGGGGAGGGGCCCTGCTGG + Intergenic
1106272267 13:28166408-28166430 GGACTGGGGGTGGGTCCTGAAGG + Intronic
1108422539 13:50265741-50265763 GGGCTGGGAAGGGAGCCAGGGGG - Intronic
1108958214 13:56187562-56187584 GGGCTGGCGCGGGTTCCAGGTGG + Intergenic
1109822712 13:67679551-67679573 GGACTGGGGAGGGGAAAAGAGGG - Intergenic
1112334308 13:98501361-98501383 GGGGTGGGGCGGGGGCCAGGAGG + Intronic
1112692941 13:101916770-101916792 GGACTGGGGAGAGGGGAAGGGGG + Intronic
1113619353 13:111702399-111702421 GGACGTGGGAGGGGTGAAGGTGG + Intergenic
1113624882 13:111787660-111787682 GGACGTGGGAGGGGTGAAGGTGG + Intergenic
1113664859 13:112134454-112134476 GGCCTGTGGAGGAGCCCAGGAGG + Intergenic
1113711838 13:112470254-112470276 GAAATGGGGAGGGGTTCAGTGGG - Intergenic
1114555740 14:23561344-23561366 CTCCTGGGGAGGGGTCCAGATGG + Exonic
1115203043 14:30874347-30874369 GGACTGGCGCCGCGTCCAGGTGG + Intergenic
1117648928 14:57882166-57882188 GGAAGGGGGATGGATCCAGGAGG - Intronic
1118295671 14:64566692-64566714 GGAATGGGGAGGGGTGCAAATGG - Intronic
1118770751 14:68941065-68941087 GGACTTGGGAGGGGTTCCTGTGG + Intronic
1119348467 14:73944941-73944963 GGACTGGGGAGGAGGTCTGGAGG - Intronic
1119653820 14:76402450-76402472 GGACTGGGGAGGAGGGAAGGAGG + Intronic
1119773599 14:77235928-77235950 GGGTGGGGGAGGTGTCCAGGGGG + Intronic
1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG + Intronic
1120244062 14:81985023-81985045 GGAGTGTGAAGGGGTCCAGTAGG - Intergenic
1122037865 14:98961494-98961516 GGCCTGAGGAGGGGCCCTGGAGG - Intergenic
1122122947 14:99564301-99564323 GGTCTGGGGAGGGTGCAAGGAGG - Intronic
1122184798 14:99983519-99983541 GGACTGGAGAAGGGTGTAGGCGG - Intronic
1122198802 14:100109366-100109388 GGACTGGGAAGGGGTGCCTGAGG - Intronic
1122208386 14:100159677-100159699 GGGCGGGGGCGGGGTCCCGGCGG + Exonic
1122315047 14:100821053-100821075 GGCCTGGGGAGGGGCCCCAGAGG - Intergenic
1122316374 14:100828057-100828079 TGGCTGGAGAGGCGTCCAGGGGG + Intergenic
1122415080 14:101545578-101545600 GGAGTGGGGTGGGGTGGAGGGGG - Intergenic
1122457812 14:101868418-101868440 GAACTGGGGAGGGGTGAAGTAGG - Intronic
1122603129 14:102930924-102930946 GGACATGGGAGGGGTCTAGCTGG + Exonic
1122782629 14:104150117-104150139 GGACGGGGAGGGGGACCAGGAGG - Intronic
1122842251 14:104471856-104471878 GGAGTGGGGACTGGTGCAGGTGG - Intergenic
1122842269 14:104472012-104472034 GGAATGGGGATGGGTGCAGGTGG - Intergenic
1122972776 14:105159113-105159135 GGACTGGGTGGGGGTCCTGGAGG - Intronic
1122985905 14:105211534-105211556 GCACTGGGGTGGGGCCCAGTAGG - Intronic
1123041493 14:105492034-105492056 GGTCTCTGGAGGGATCCAGGTGG + Intronic
1123806307 15:23877545-23877567 GGACAAGGGAGGTCTCCAGGAGG + Intergenic
1123811603 15:23932360-23932382 GGACAAGGGAGGCCTCCAGGAGG + Intergenic
1123827730 15:24100919-24100941 GGACAGGGGAAGCCTCCAGGAGG + Intergenic
1123842186 15:24260331-24260353 GGACAGGGGAAGCCTCCAGGAGG + Intergenic
1123857209 15:24426391-24426413 GGACAGGGGAAGCCTCCAGGAGG + Intergenic
1123861841 15:24476919-24476941 GGACAGGGGAAGCCTCCAGGAGG + Intergenic
1123982489 15:25616548-25616570 GGCCTGTGGAGGGGCCCACGAGG - Intergenic
1125398474 15:39275155-39275177 GGGCTGGGGAGAGGGGCAGGAGG - Intergenic
1125589896 15:40847543-40847565 GGACTGGGGAGGAGGAGAGGTGG - Intronic
1125728943 15:41882246-41882268 GTAGTGGGGAGGGGTGGAGGCGG - Intronic
1127452887 15:59133869-59133891 GGTCTGGGGATGAGTTCAGGAGG + Exonic
1127691664 15:61403009-61403031 GGGCTGGGGAGGGGTGGGGGAGG - Intergenic
1128087440 15:64895746-64895768 GGACTGGGGGTGGGGGCAGGGGG + Intronic
1128212076 15:65909844-65909866 AGACTGGGGAGGGGTACCTGGGG - Intronic
1128496084 15:68199495-68199517 GGAGAGGGGAGGGGCCCAGCAGG - Intronic
1128568847 15:68718818-68718840 GGGCTGGGCTGGGCTCCAGGAGG + Intronic
1128747438 15:70124399-70124421 GGACTGGGTAGGTGACCAGTTGG - Intergenic
1129109819 15:73330804-73330826 AGACTGGAGTGGGGACCAGGAGG + Intronic
1129295255 15:74596580-74596602 GGACTGGGGAGGGCTGAAGAGGG - Exonic
1129440816 15:75579505-75579527 GGGCGGGGGAGGGGACCGGGAGG + Intergenic
1130975828 15:88773396-88773418 GGACTGGGTAGGGGTTGTGGGGG + Intergenic
1131119785 15:89814949-89814971 GGACGGGGGAGGAGCCCGGGCGG - Intronic
1131431147 15:92390412-92390434 GGACGGGGGAGGGAGCAAGGGGG - Intergenic
1132411185 15:101579289-101579311 GAAGTGGGGAGGGGGGCAGGGGG - Intergenic
1132855926 16:2044488-2044510 GGCCTGGGGGGGGCTTCAGGGGG + Intronic
1133013579 16:2928761-2928783 GGGCTGGGGTGGGGGCCTGGGGG - Intronic
1133205668 16:4232058-4232080 GGCCTGGGGTGGGGCCCAGCGGG - Intronic
1133277365 16:4646976-4646998 GTACTGAGGTGGGGTCCAGAAGG - Intronic
1133876128 16:9736304-9736326 GGACCAGGGAGGGGCCTAGGAGG - Intergenic
1135015930 16:18925678-18925700 GGCCTGGGGTCGGGACCAGGAGG - Intronic
1135151599 16:20011620-20011642 GGAATGGGGAGGACTCCACGTGG + Intergenic
1135418953 16:22291516-22291538 TGCCTGGGAAGGGGTCCAGGGGG - Intergenic
1135504085 16:23021406-23021428 AGACTGAGGAGGGGTCCAGAAGG - Intergenic
1135804668 16:25531984-25532006 GGACTGGGGTGAGGTCCAAGAGG - Intergenic
1136042984 16:27595011-27595033 GGACTGGCCAGGGTTTCAGGAGG + Intronic
1136071183 16:27788239-27788261 GCCCTGGGGAGGGGACCATGCGG - Exonic
1136077729 16:27828390-27828412 GGATTGGTGATGGCTCCAGGAGG - Intronic
1136171626 16:28493407-28493429 GGGCTGGGGAGGGGAGAAGGAGG + Intronic
1136221077 16:28829381-28829403 GGACTGGGGAGGGAGGAAGGTGG - Exonic
1136580457 16:31148398-31148420 CGGCTGGGGAGACGTCCAGGAGG - Exonic
1137560085 16:49496921-49496943 GGAAGGGGGAGGGGTACAGCTGG - Intronic
1137718439 16:50613002-50613024 GGGCTGGGGAGAGGTCCATGGGG + Intronic
1137798073 16:51238721-51238743 GGTCAGGGCAGGGGTCCAGCTGG - Intergenic
1138375822 16:56563366-56563388 GCACTGGGGAGGGGAGGAGGGGG - Intergenic
1138441273 16:57036477-57036499 GCACTGGGGAGGTGTCAGGGTGG + Intronic
1138605355 16:58085083-58085105 AGTCTGGGGAGGCTTCCAGGAGG - Intergenic
1139341666 16:66271492-66271514 GGCCTGGGGATGGGTCCACCAGG + Intergenic
1139354819 16:66361212-66361234 TGGCTGGGGAGGAGGCCAGGTGG - Intergenic
1139710850 16:68774735-68774757 GCACTGGGGAGGACACCAGGAGG + Intronic
1139754407 16:69131813-69131835 CGAGTGGGGTGGGGTCCTGGAGG - Intronic
1140002430 16:71039342-71039364 AGACTGGGGAGGGTACCAGCAGG - Intronic
1140027386 16:71303091-71303113 GCCCTGGGGAGTGGTCCATGTGG - Intergenic
1140902572 16:79383216-79383238 GGACTGGGGTGGGGGCAGGGTGG + Intergenic
1140949153 16:79799276-79799298 AGACTGGGGAGGGGTGTGGGTGG - Intergenic
1141399563 16:83735274-83735296 GGACTGGGGAGAGGTCCTTTGGG - Intronic
1141581607 16:85003239-85003261 GGACTGAGGCTGGGTCCAGGGGG + Intronic
1141690056 16:85591531-85591553 GTGCTGGGGAGGGGTCCTGGAGG + Intergenic
1141855386 16:86677717-86677739 GGAGAGGGGAGGGGGGCAGGGGG - Intergenic
1142291675 16:89196085-89196107 GGAGTGGGGAGCGGCGCAGGCGG + Exonic
1142303647 16:89273868-89273890 GGGCTGGGGTGGCGTCAAGGGGG + Intronic
1142429833 16:90019811-90019833 GGGCTGGCGAGGGGCACAGGAGG + Intronic
1142778943 17:2165392-2165414 GGAGTGGGAAGGGGACCAAGTGG - Intronic
1142806095 17:2372071-2372093 GCACTGGGGAGGGTGCGAGGAGG - Intronic
1142961824 17:3556364-3556386 GGACGGGGAAGGGGGCCAGCTGG + Intronic
1143087429 17:4426676-4426698 GGACTAGGGAGGGGTTCTTGAGG - Intergenic
1143096933 17:4483157-4483179 GGCCTGGGTGGGGGTGCAGGAGG + Intronic
1143119644 17:4598926-4598948 GGGCTGGGGCCGGGGCCAGGTGG - Intronic
1143476860 17:7208043-7208065 GCACTGGGGAGGGGGCCACCAGG + Intronic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1143609089 17:8007317-8007339 GCTCAGGGGAGGGGTCCTGGAGG - Intronic
1143747672 17:9005494-9005516 CGTCTGGGGAGGGGCCCAGAAGG + Intergenic
1143863528 17:9908080-9908102 GGACAGGGGTGCGATCCAGGAGG - Intergenic
1143900332 17:10169689-10169711 GGTCTGGGGATGGGGCCTGGAGG - Intronic
1143908567 17:10228890-10228912 GGACTAGGGTGGAGTGCAGGAGG - Intergenic
1144029163 17:11304246-11304268 GCACTGGGGAGGTGGCCGGGTGG + Intronic
1144163169 17:12581639-12581661 GGGGTGGGGAGGGGCACAGGTGG - Intergenic
1145898510 17:28474698-28474720 GGCTTTGGGAAGGGTCCAGGGGG + Intronic
1146000178 17:29126212-29126234 GGCCTGGGGAAGGGTCCAGAGGG - Intronic
1146793655 17:35766670-35766692 GGACTGGGGAGGCATCCCTGAGG - Exonic
1146946549 17:36877503-36877525 CCACTGGGGAGGGGCCCTGGGGG + Intergenic
1147371072 17:39993473-39993495 GGAATGGTAAGGGGGCCAGGAGG - Intronic
1147586725 17:41657303-41657325 GGACAGAGGAGGGGGCCATGGGG - Intergenic
1147656256 17:42092810-42092832 GGGCTGGGGAGGGGGTCAGCTGG + Intergenic
1148442678 17:47719885-47719907 GGAGTGGGGAGGGGTTGGGGTGG + Intergenic
1148674691 17:49438568-49438590 GGATGGGGGAGGGGGCCGGGGGG + Intronic
1148710219 17:49674877-49674899 AGATTGGGGAGGGGTCATGGAGG - Intronic
1150640403 17:66945859-66945881 GGATTGGGAAGGGGTCTAGGAGG + Intergenic
1151353127 17:73543219-73543241 GGGCTGGGGAGGGGAGGAGGAGG + Intronic
1151519618 17:74618812-74618834 GGGCTGGGAAGGGGTCAGGGTGG - Intronic
1151570569 17:74923532-74923554 GAGCTGGGGAGGGGTGCCGGAGG + Intergenic
1151729218 17:75901115-75901137 GGGCTGGGGGAGGGGCCAGGTGG - Intronic
1152068908 17:78125665-78125687 GGCCTGGGGTGGGGTGCAAGAGG - Intronic
1152253483 17:79224023-79224045 GAACTGGCGAGGTGTGCAGGAGG - Intronic
1152407149 17:80104381-80104403 AGACTGGGGAGAGGGCCAGAAGG - Intergenic
1152494830 17:80663726-80663748 TGACTGGGGAGGGGCTCAGAGGG - Intronic
1152550745 17:81028717-81028739 AGACGGGGGAGGGGGCGAGGTGG + Intergenic
1152559192 17:81069437-81069459 AGGCTGGGGAGTGGTCCACGGGG + Intronic
1152584677 17:81183654-81183676 GGACTGGGCTGGGGTCCTGCCGG - Intergenic
1152602359 17:81270850-81270872 GGGCTGGGGAGAGGTGGAGGCGG - Intronic
1152637385 17:81435709-81435731 GTCCTGGGGAGGGCTCCAGGGGG - Intronic
1152762802 17:82118209-82118231 GGAGTCTGGAGGGGTGCAGGGGG + Intronic
1152932990 17:83119959-83119981 GGGCTGGGGAGGGGTTGGGGAGG + Intergenic
1152933024 17:83120024-83120046 GGGCTGGGGAGGGGTTGGGGAGG + Intergenic
1152933047 17:83120067-83120089 GGGCTGGGGAGGGGTTGGGGAGG + Intergenic
1154096785 18:11424419-11424441 GGACTCTGGAGGGATGCAGGAGG - Intergenic
1154177127 18:12093060-12093082 GCACTGGGGAGGGGTCCTGGAGG + Intergenic
1154503311 18:15007239-15007261 GGAATGGGAAGGGGTCCTCGTGG - Intergenic
1154971397 18:21413258-21413280 GGACAGAGGAGGAGTCCTGGGGG - Intronic
1155307755 18:24495741-24495763 GTCCTGGGGAGGGGCCCATGTGG + Intergenic
1156362986 18:36400637-36400659 GGCCTGGGGAAGGGACCAAGAGG + Intronic
1156414363 18:36872151-36872173 GTGCTGGGGCTGGGTCCAGGTGG + Intronic
1158434831 18:57428367-57428389 GGAATGGCGCCGGGTCCAGGCGG - Intergenic
1159117996 18:64136970-64136992 GATTTGGGGAGGGGTGCAGGTGG - Intergenic
1159761202 18:72429345-72429367 AGACTTGGGAGAGGTCGAGGTGG - Intergenic
1160113593 18:76056763-76056785 GTACGGGGGAGGGGACGAGGAGG + Intergenic
1160509001 18:79442860-79442882 GGAGTGGGGAGCTGTCCGGGTGG - Intronic
1160696298 19:486212-486234 GGGCTGGAGAGGGGTCCTAGTGG + Intergenic
1160698998 19:497338-497360 GGAGAGGGGAGGGGGCCCGGGGG + Intronic
1160780621 19:876489-876511 GGAGAGGGGAGCCGTCCAGGGGG + Intronic
1160799411 19:960852-960874 GGTCTGGGCTGGTGTCCAGGTGG + Intronic
1160842523 19:1152585-1152607 GAACTAGGGAGGGGGACAGGAGG + Intronic
1160895505 19:1400242-1400264 GGGCTGGGGAGGCTTCCTGGAGG + Intronic
1160960461 19:1718565-1718587 GGGCGGAGGAGGGGTGCAGGGGG + Intergenic
1160963437 19:1734946-1734968 GGATGGGGCAGGGGCCCAGGAGG + Intergenic
1160982639 19:1823386-1823408 GGACTGTTGAGGGGTGCAGGAGG - Intronic
1161203504 19:3028789-3028811 GGACTGGAGCGGGGTCTGGGGGG + Exonic
1161286192 19:3469657-3469679 TGAGTGGGGAGGGGGCGAGGAGG - Intergenic
1161300115 19:3538440-3538462 GGACTGGGGAGGGGGACCTGGGG - Intronic
1161776328 19:6264237-6264259 GGGGTGGGGAGGGGTGGAGGGGG - Intronic
1161818536 19:6515356-6515378 GGTCTGGGGTGGGGTCTTGGTGG + Intergenic
1161846370 19:6713787-6713809 GGGCTGGGGGTGGGACCAGGTGG - Intronic
1161846418 19:6713882-6713904 GGGCTGGAGATGGGACCAGGTGG - Intronic
1161919411 19:7255007-7255029 GGACCGGGGAGGGGGGCCGGGGG - Intronic
1161936121 19:7373114-7373136 GGACAGGGAAGAGGTCCAGAAGG + Intronic
1162381903 19:10336037-10336059 GGACTGGGGAGGAGACAGGGTGG + Intronic
1162850833 19:13429990-13430012 GGAGTGGGGAGGGGGGAAGGGGG + Intronic
1163126438 19:15246712-15246734 GGCCTGTGGGGGGTTCCAGGGGG + Intronic
1163386177 19:17001796-17001818 GGGCAGAGGAGGGGCCCAGGGGG + Intronic
1163476213 19:17527413-17527435 GGACAGGGTGGGAGTCCAGGTGG + Intronic
1163622347 19:18368630-18368652 GCCCTGGGGAGGTGACCAGGTGG + Exonic
1163717256 19:18879636-18879658 GGACTGGGAAGGGGAGGAGGTGG - Intronic
1164442216 19:28287880-28287902 GGACTGGGAAGGGTGCCAGGTGG + Intergenic
1164671457 19:30074447-30074469 GGAATGGTGAGGGGTGAAGGGGG - Intergenic
1164920365 19:32084553-32084575 GGATTGGAGAAGGGTTCAGGAGG - Intergenic
1165078380 19:33293619-33293641 GGGGTGGGGATGGGTCAAGGGGG - Intergenic
1165317440 19:35065461-35065483 GGAATGGGGTGGGCACCAGGAGG + Intronic
1165829579 19:38723853-38723875 GGGGTGGGGAGGGGTCCAGAGGG - Intronic
1165867863 19:38949943-38949965 TGACGGGGGCGGGGCCCAGGAGG - Intronic
1166015126 19:39973961-39973983 GCACATGGGAGGTGTCCAGGAGG + Intronic
1166361176 19:42253672-42253694 GGACCGAGGAGGGGCCCTGGGGG - Intronic
1166364005 19:42269457-42269479 GGACGGGGAGGGGGTACAGGGGG + Intronic
1166367600 19:42285238-42285260 GCACTGGGGAGGGGTTCAGGAGG + Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166674806 19:44733636-44733658 GGGATGGGGAGGGGTGCAGAGGG - Intergenic
1166688396 19:44809233-44809255 GGACTGGGGAGAGGCCCCTGGGG + Intronic
1166846278 19:45730658-45730680 GGCTTGGGGAGGGGTCTTGGAGG - Intronic
1166870700 19:45868721-45868743 GCAGTGGGGAAAGGTCCAGGTGG + Intronic
1166960987 19:46495666-46495688 GCTCTGGAGAGGGGTCCCGGGGG - Exonic
1166979691 19:46625214-46625236 GGAGTGGGGAGTGTGCCAGGGGG - Intergenic
1167276973 19:48544888-48544910 AGACTGGGGAGGGATGCTGGGGG - Intergenic
1167321559 19:48799906-48799928 GGGCAGGGGTGGGGTCCTGGAGG - Intronic
1167649928 19:50723618-50723640 AGGCTGGGGAGGTGCCCAGGAGG + Exonic
1167665886 19:50822632-50822654 GGACTGGGACGGGGCTCAGGAGG + Intronic
1167679331 19:50909651-50909673 GGGCTGGGGGCGGGCCCAGGGGG + Intronic
1167713403 19:51125733-51125755 GGGTGGTGGAGGGGTCCAGGGGG - Exonic
1167785221 19:51630344-51630366 GGACTGGGCTGGGGCCCTGGCGG - Intronic
1167787320 19:51646768-51646790 GGACTGGGCTGGGGCCCTGGCGG - Exonic
1168147614 19:54428861-54428883 CGGGTGGGGAGGGGTGCAGGGGG - Intronic
1168351879 19:55680672-55680694 GCACAGGGCAGGGGTCCAGGAGG + Intronic
925208510 2:2027034-2027056 GAGGTGGCGAGGGGTCCAGGTGG - Intronic
927865676 2:26585854-26585876 GGGCTGGGGAGGGGAGCATGAGG - Intronic
928656720 2:33459656-33459678 GGAGTGGTGAGGGGACAAGGAGG + Intronic
929452399 2:42046731-42046753 TGGCTGGGGAGGGGTCAGGGAGG - Intergenic
929777559 2:44938507-44938529 GGACTGGGAAGGGACCCTGGGGG - Intergenic
929883971 2:45862353-45862375 CCACTGGAGAGGGATCCAGGAGG - Intronic
930479014 2:51923878-51923900 GCCCTGTGGAGGGGTCCATGTGG + Intergenic
930534549 2:52630124-52630146 GGACAGGGAAGGGGACTAGGAGG - Intergenic
931197246 2:60064332-60064354 GCAGTGGGGAGGGGTGGAGGAGG + Intergenic
932314023 2:70767858-70767880 GGTCTGGGGAGCGGGCCTGGTGG - Intronic
932608377 2:73179329-73179351 GGACTGGAGAGGGGTACAAAAGG + Intergenic
932687383 2:73883525-73883547 GGAGTGGGGAGGGGTGAAGAGGG + Intergenic
932885977 2:75549542-75549564 AGAGTGGGGAGGGGTCCGGCAGG + Intronic
933818607 2:86089335-86089357 GGTCTGGGGTAGGGTCCAAGTGG - Intronic
934056061 2:88252695-88252717 CCACTGGGGAAGGGTCCTGGGGG - Intergenic
934687882 2:96335063-96335085 GGAATGAGGAGCGGTCCAGGTGG - Intergenic
936233848 2:110726362-110726384 GGGCTGGGGAAGGATTCAGGAGG + Intergenic
936887869 2:117334737-117334759 GGAATGGGGAGGGCTCTAGTTGG + Intergenic
937260209 2:120580723-120580745 CCAGTGGGAAGGGGTCCAGGAGG - Intergenic
937334841 2:121055734-121055756 GGCCTGGGGAGGGTTCCCTGGGG + Intergenic
938056454 2:128219016-128219038 AGACAGGGGCGGGGTGCAGGAGG - Intergenic
938127429 2:128684703-128684725 GGACTGGGGCTTGGTCCAGGTGG - Intergenic
938129045 2:128694918-128694940 TGCCTGGGGAGAGGTCCAAGTGG - Intergenic
938386781 2:130872447-130872469 GGCCTGGGCAGGGGGCCTGGGGG - Intronic
938452760 2:131437193-131437215 ACACTGGTGAGGGGACCAGGTGG - Intergenic
938502489 2:131837400-131837422 GGAATGGGAAGGGGTCCTCGTGG - Intergenic
939529903 2:143345459-143345481 GGGTTGGGGTGGGGTTCAGGTGG - Intronic
940849275 2:158672793-158672815 GGACAAGGGAGGGGAGCAGGTGG - Intronic
941739841 2:169023816-169023838 AGACTGGGGAGGGGCTCAGAGGG + Intronic
942135100 2:172917496-172917518 GGGTTGGGGAGGGGTGCAGGGGG + Intronic
942789890 2:179748892-179748914 GCACTGGGGAAGTGTCCAGGTGG + Intronic
943009576 2:182430948-182430970 GGACTGTGGTGGGGTCGGGGAGG + Intronic
944448725 2:199819261-199819283 GCACTGGGGCAGGGTCCTGGAGG - Exonic
944964493 2:204914793-204914815 GGACTGTGGAGTGGCCCACGCGG + Intronic
945385570 2:209195846-209195868 GGTCTGTGGAGGGGGGCAGGAGG + Intergenic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
946326094 2:218985363-218985385 GGGCGGGGGCGGGGTCCTGGGGG - Exonic
946414852 2:219534908-219534930 GGACTGGGGGGGGGTCCTCGTGG - Intronic
946879390 2:224162025-224162047 AGGCTGGGAAGGGGTGCAGGAGG - Intergenic
947386232 2:229593344-229593366 GTTCTGGGCAGGGGTCCAGCAGG - Intronic
948048007 2:234958366-234958388 GGACTGGGGAGAGGCACACGAGG + Intronic
948051089 2:234979839-234979861 AGACTGGGGAGGGGTCCTCCAGG - Intronic
948077185 2:235174045-235174067 GGACTGGGGAGGAGGTCAGGAGG + Intergenic
948542599 2:238701313-238701335 AGGCTGGGGAGGGGTCAGGGAGG - Intergenic
948635006 2:239329203-239329225 GGACTCAGAAGGGGTCCACGGGG + Intronic
948815810 2:240509966-240509988 GGACAGGGGAGGAGTCAGGGAGG - Intronic
948815930 2:240510312-240510334 GGACGGGGGAGGAGGGCAGGAGG - Intronic
948844963 2:240678700-240678722 GGCCTGGGCAGGGTTCCGGGTGG - Intronic
948845719 2:240681984-240682006 GGACTGGGGAGAGGTGCAGTGGG + Intronic
948847519 2:240690257-240690279 GGGTTGGGGAGGGGGACAGGCGG + Intergenic
948848138 2:240692746-240692768 CGACTGGGGAGAGGTGCAGTGGG - Intronic
948848897 2:240696179-240696201 GGCCTGGGCAGGGTTCCGGGTGG + Intronic
948860380 2:240750027-240750049 GGCTGGGGGAGGGATCCAGGTGG + Intronic
948907984 2:240988916-240988938 GACCTGGGGTGGGATCCAGGAGG + Intronic
948912034 2:241009660-241009682 GGACAGGGGAGGGGTAAGGGAGG - Intronic
1168830244 20:841642-841664 CTAGTGGGGAGGGGGCCAGGTGG + Intronic
1169073729 20:2749499-2749521 GACCTTCGGAGGGGTCCAGGCGG - Exonic
1169214490 20:3785487-3785509 GGAGAGGGGAGTGGTCCAGCAGG - Exonic
1170737881 20:19026817-19026839 GGACTGTGGAGGGGGTCAAGAGG - Intergenic
1170840721 20:19922812-19922834 AGTATGGGGTGGGGTCCAGGTGG - Intronic
1171558138 20:26096633-26096655 GGTCCGGGGAGGAGTCCTGGGGG - Intergenic
1172008074 20:31830940-31830962 GGACAGGGGTGGGGTGGAGGGGG + Intronic
1172108052 20:32528330-32528352 GGCCTGGGCTGGGGTCCCGGGGG + Intronic
1172426609 20:34860083-34860105 GGAATGAGGAGGGGTCCGGGGGG + Intronic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1172506388 20:35466014-35466036 GCACTGGGGAGGGGTAAAAGTGG - Intronic
1172529397 20:35619452-35619474 GGACTGGGGCGGGCTGGAGGTGG + Intronic
1172608933 20:36234962-36234984 GGAGTGGGGAGGGGTGGAGAGGG + Intergenic
1172871973 20:38141705-38141727 GGGCTGGGGCGTGGTCCAGGTGG - Intronic
1173176972 20:40771864-40771886 GGACTGGTTGGGGGTCCTGGAGG - Intergenic
1173681474 20:44885514-44885536 GGCCGGGGGAGGGACCCAGGAGG - Intergenic
1173707651 20:45124315-45124337 GGGCTGGGGAGAGGTCCTGAGGG - Intronic
1173883276 20:46435159-46435181 GGACTGGGGAGATGGCCATGGGG + Intergenic
1174282148 20:49447152-49447174 GTGCTGGGGAGGGGCCCAGGAGG + Intronic
1175199389 20:57267118-57267140 TGAGTGGGGAGAGGTCCAGGCGG - Intergenic
1175324350 20:58112323-58112345 AGACTGAGGAGGACTCCAGGAGG - Intergenic
1175831769 20:61968568-61968590 GGGCTGGGGAAGGGCGCAGGTGG - Intronic
1175838030 20:62008699-62008721 GGAGTGGGGAGAGGGCCAGAAGG + Intronic
1175921174 20:62451251-62451273 GGGCTGGGGTGGGGAGCAGGTGG - Intergenic
1175967812 20:62668381-62668403 TGGCTGGGGACTGGTCCAGGAGG + Intronic
1175994229 20:62805149-62805171 GGTCTGGGGGGGGGTCCCCGGGG - Intronic
1176115199 20:63429153-63429175 GGAGTGGGGAGGGGTGAAGAGGG - Intronic
1176141720 20:63547793-63547815 GGGCGGGGGCGGGCTCCAGGAGG + Intergenic
1176373613 21:6076745-6076767 GGCCCGGGGAGAGTTCCAGGGGG + Intergenic
1178938969 21:36889066-36889088 GCACTGGAGAGGTGTCCTGGCGG - Intronic
1179124793 21:38581158-38581180 GGAATGGGGATGGGTTCAGCTGG + Intronic
1179334718 21:40439958-40439980 GCATTGGGAAGGGGTCCAGAAGG - Intronic
1179498409 21:41790589-41790611 GGAATGGGGAGGGATCAGGGAGG + Intergenic
1179498488 21:41790772-41790794 GGAATGGGGAGGGATCAGGGAGG + Intergenic
1179654592 21:42837550-42837572 GGACTGGGGAGGGGAGCAAGGGG - Intergenic
1179656747 21:42850562-42850584 GCCCTGTGGAGGGGCCCAGGTGG + Intronic
1179749864 21:43461498-43461520 GGCCCGGGGAGAGTTCCAGGGGG - Intergenic
1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG + Intronic
1180002620 21:45002131-45002153 GTGCTGGGGAGGGGTCAGGGAGG + Intergenic
1180027811 21:45178311-45178333 AGCCTGGGGAGGGGTGCAGGTGG + Intronic
1180050376 21:45328378-45328400 GTACTGGGGCGGCGTCCAGAAGG - Intergenic
1180095297 21:45553648-45553670 GGACTGGGAAGGGGGCGCGGGGG - Intergenic
1180095510 21:45554093-45554115 GGACTGGGAAGGGGGCGCGGGGG - Intergenic
1180095645 21:45554374-45554396 GGACTGGGAAGGGGGCGCGGGGG - Intergenic
1180205322 21:46256096-46256118 GGACTGGGGAGGCAGCCTGGAGG - Intronic
1180726217 22:17948451-17948473 GGACTGGGGAGGGGAGGAGCAGG - Intronic
1180875723 22:19174476-19174498 GGGCTGGGGAGGGCTCGGGGTGG - Intergenic
1181603675 22:23967123-23967145 GGAGTGGGGAGTGGTCCCTGGGG - Intronic
1181604838 22:23974184-23974206 GGAGTGGGGAGTGGTCCCTGGGG + Intronic
1181862846 22:25832940-25832962 TCCCTGGGGAGGGGTCCGGGAGG - Exonic
1181948733 22:26539196-26539218 GGCCTGGGAAGGGGCCCAGCAGG + Intronic
1182279185 22:29208297-29208319 GGCCTGGGAAGGCATCCAGGGGG + Intronic
1182563923 22:31183947-31183969 GGACGGGGCAGCTGTCCAGGCGG + Intronic
1182868930 22:33628848-33628870 GGTCTGGGGTGGGGGGCAGGGGG + Intronic
1183198204 22:36367853-36367875 GGACTGGGGAGGGGAGGAGGGGG - Intronic
1183253818 22:36747915-36747937 GGACTGGAGAGAGGCCCAGCAGG - Intergenic
1183254481 22:36753564-36753586 GGACTGAGGAGGTGGCCTGGAGG - Intergenic
1183258077 22:36775916-36775938 GGGCAGGGGAGGGCTCCAGGTGG + Exonic
1183322520 22:37173755-37173777 GGGTTGGGGAGGGGTCCTGGAGG + Intronic
1183363303 22:37394202-37394224 GGCCTGGAGAGGTGTCGAGGTGG - Intronic
1183508249 22:38221005-38221027 GGACAGGGGAGGGATGCAGGCGG + Exonic
1183622745 22:38983955-38983977 GGGCTGTGGAGGGGTCGGGGAGG + Intronic
1183704613 22:39469113-39469135 GGTGTGGGGAGGGGCCCAGAAGG + Intronic
1183715330 22:39529957-39529979 GGACTGAGAATGGTTCCAGGGGG - Intronic
1183729573 22:39610384-39610406 GGACTGGGGAAGGTTCCAATAGG + Intronic
1183960132 22:41406490-41406512 GGACTGGGGATGGGGGTAGGGGG - Intergenic
1184038216 22:41928540-41928562 GGGCTGGGGAGGGAGCCTGGGGG + Intergenic
1184087320 22:42272661-42272683 GGACTGGGGAAGTTTCCAGGTGG - Intronic
1184236908 22:43187429-43187451 GGGCAGGGGAGGGGTCGGGGGGG - Intergenic
1184303322 22:43577001-43577023 GGACAGGGGTGGGGTCAGGGTGG - Intronic
1184308510 22:43625641-43625663 GGGCTGGGCAGGGGCCTAGGGGG + Intronic
1184614915 22:45631434-45631456 GCACTAGGGAGGTGTCCAGGAGG + Intergenic
1184686039 22:46096771-46096793 GGCCTGGGGAGGGTTCCAGGGGG + Intronic
1184687966 22:46104931-46104953 GGGCTGTGGAGGGGCCCAGGAGG - Intronic
1184704342 22:46200142-46200164 GAACTGGGGAGGGGTCCCATGGG + Intronic
1184899026 22:47432692-47432714 GGAGGAGGGAGGGGCCCAGGGGG + Intergenic
1184922505 22:47615317-47615339 AGCCTGAGGAGGGGTCCAGGTGG + Intergenic
1185040492 22:48501473-48501495 GGACCAGGAAGGCGTCCAGGAGG - Intronic
1185191027 22:49436213-49436235 GCACTGGGCAGGGGTCACGGCGG - Intronic
1185191170 22:49437518-49437540 TGACTGGGACGGGGTCCTGGTGG - Intronic
1185330299 22:50249266-50249288 GGGGAGGGGAGGGGCCCAGGGGG + Intronic
949147479 3:720091-720113 TGACTAGGGATGGGTGCAGGAGG + Intergenic
949708026 3:6841286-6841308 GGAAGGGGCAGGGGTGCAGGTGG - Intronic
950024543 3:9811132-9811154 GACCTGGGGAAGGGGCCAGGGGG - Intronic
950702804 3:14761728-14761750 GGAGTGGGGAGGGGGGCTGGAGG + Intronic
952118207 3:30209733-30209755 AGAATGGGGAAGGGTCAAGGAGG + Intergenic
952120489 3:30237488-30237510 GGACTGGGAAGGGGTGGAGATGG - Intergenic
952307924 3:32161873-32161895 GGAATGGGGAGGAGTCCCAGGGG - Intronic
952331476 3:32367763-32367785 GGTGTGGGGAGGGGCCCAAGTGG - Intronic
953709099 3:45254936-45254958 GCACTGTGGAGAGGTCCACGTGG + Intergenic
954106282 3:48411397-48411419 CGACAGGGGAGGGGTTCAGCAGG + Intronic
954176102 3:48847296-48847318 GCCCTGGGGAGTGGTGCAGGAGG - Intronic
954502232 3:51029507-51029529 GCACTGGGGAGGGGAACAGGGGG + Intronic
954697292 3:52434708-52434730 GAGCTGGGGAAGGGTGCAGGCGG - Exonic
954713522 3:52516243-52516265 GGACTGGGGAGGGGCGGGGGTGG + Intronic
954864680 3:53718557-53718579 GGGGTGGGGAGGTGTGCAGGAGG - Intronic
955044851 3:55350219-55350241 GACCTGGGGTGGGGCCCAGGTGG + Intergenic
955060729 3:55489528-55489550 GGGCTGGGGAAGGGTCCAGTCGG - Intronic
955564846 3:60233030-60233052 TGACTGGGAAGGGGTGCAGCTGG + Intronic
955755329 3:62219948-62219970 GGAAAGGGGAGGGGCCCATGGGG + Intronic
955895977 3:63700222-63700244 GTCCTGGGGTGGGGGCCAGGGGG + Intergenic
956267126 3:67409178-67409200 GGGCTGGGGAGGGGTCATGAAGG + Intronic
958798779 3:98733041-98733063 GGTCTGGGCCGGGGTCCGGGCGG + Intronic
960036286 3:113105839-113105861 GGACTGGGGAGGGAAGCATGGGG - Intergenic
960152549 3:114264977-114264999 GGACTTGGGAGGAATCCAGGTGG - Intergenic
960228507 3:115195990-115196012 GGGCGGGGGGGGGGGCCAGGGGG + Intergenic
960664165 3:120094214-120094236 GGACGGGGGAGGGGGCCCCGAGG - Intronic
960968901 3:123125118-123125140 GGCCTGGGGAGGCTTCCAGAAGG - Intronic
961064849 3:123866685-123866707 GTACTGGGGAGGGGACAATGTGG - Intronic
961366569 3:126403255-126403277 GCACTGGTGAGGCGTCTAGGAGG + Intronic
961742135 3:129039594-129039616 GGGCTGGGGAGGGGCACAGCGGG + Intronic
961768628 3:129231820-129231842 AGACTGGAGAGGGGTAGAGGGGG + Intergenic
962403397 3:135080331-135080353 AGAAGGGGGAGGGGTGCAGGAGG + Intronic
964714634 3:159708881-159708903 GGAGTGGGGAGGTGCACAGGGGG + Intronic
965785036 3:172326715-172326737 AGACTGGGGAGGGTTCGAAGGGG - Intronic
966871463 3:184292616-184292638 AGCCTGGGGAGAAGTCCAGGAGG - Exonic
967018610 3:185503381-185503403 GTACTGGGTTGGGGGCCAGGAGG - Intergenic
968498427 4:931925-931947 GGGCTGGGGAGGGTCCCAGCGGG - Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
968511279 4:996981-997003 AGACTGGCCAGGGGTTCAGGCGG - Intronic
968520685 4:1033497-1033519 GGGCCGGAGAGGGGTCCAGCTGG - Intergenic
968541644 4:1171226-1171248 GGCCGGGGGCGGGGTCCGGGGGG - Intronic
968764292 4:2459958-2459980 GAACAGGGGAGGGATCCTGGTGG + Intronic
968817390 4:2829110-2829132 GGACAGGGGAGGGGAGCAGCTGG - Intronic
968817955 4:2831491-2831513 GGAGTGGGGAGGGGAGCAGAGGG + Intronic
968944253 4:3655293-3655315 GGACAGGTGAGGGTTCAAGGAGG - Intergenic
968956659 4:3722969-3722991 GGGCTAGGCAGGGCTCCAGGCGG + Intergenic
969291660 4:6243930-6243952 GCACCTGGGAGGGGTCCTGGAGG - Intergenic
969335059 4:6502930-6502952 GCAGAGGGGAGGGGTGCAGGTGG - Intronic
969447495 4:7253545-7253567 GGGCGGAGGAGGTGTCCAGGGGG + Intronic
969718307 4:8879044-8879066 GGTCTTGGGAGGGCTGCAGGAGG + Intergenic
970966160 4:21930577-21930599 GGAATGGTGAGAGGTCCATGTGG - Intronic
971294964 4:25379791-25379813 GAAATGGGGAGGGGTCTTGGAGG + Intronic
971451243 4:26803917-26803939 GGACGGGGGAGGGGGCATGGAGG + Intergenic
972670615 4:41211383-41211405 GGGCGGGGGAGGGGAGCAGGTGG - Intronic
972749492 4:41973944-41973966 AGATTTGGGAGGGGCCCAGGCGG + Intergenic
973774523 4:54231891-54231913 GGACTGAGGAGGGATGCAGGGGG + Intronic
974036436 4:56821894-56821916 GGACGGGGGAGGGGGCCATGGGG + Intergenic
974091027 4:57311617-57311639 GGACAGGGCAGGGGTCAAGGGGG + Intergenic
974366393 4:60955149-60955171 GGGGTGTGGAGGGGTGCAGGAGG + Intergenic
977076322 4:92455485-92455507 GGCCTGGGGAGAGGTCCTTGAGG + Intronic
978362133 4:107942204-107942226 AGACTGGGGATGGGGCCTGGGGG + Intronic
978711807 4:111791316-111791338 GTAATGGGGAGGACTCCAGGAGG + Intergenic
979099924 4:116600207-116600229 GGGATGGGGTGGGGTTCAGGGGG - Intergenic
980975484 4:139606444-139606466 GGACTTGGGAGGGCTGCAGAGGG + Intronic
981531958 4:145761934-145761956 GGAGTGGGGAGGGCTCCGAGGGG - Intronic
983229157 4:165112569-165112591 GGCTTTGGGAGGGCTCCAGGCGG - Intronic
985006243 4:185537560-185537582 GGAGTTGGGAGGGGCACAGGAGG + Intergenic
985140954 4:186840448-186840470 GGACTGGGGAGGGGAGAAGGAGG - Intergenic
985610916 5:888105-888127 GGACTTGGGGAGGGTCCAGATGG - Intronic
985676108 5:1232148-1232170 GGACTGTGGCGTGGGCCAGGGGG - Intronic
985795869 5:1961842-1961864 GGGATGGGCACGGGTCCAGGGGG - Intergenic
986887325 5:12256036-12256058 GGCCTGAGAAGGGGACCAGGTGG + Intergenic
988061582 5:26176389-26176411 AGATTTGGGAGGGGTCGAGGTGG + Intergenic
988602842 5:32655618-32655640 TGTCATGGGAGGGGTCCAGGGGG - Intergenic
988860189 5:35269308-35269330 AGATTGGGGAGGGGTGAAGGAGG - Intergenic
988956388 5:36324220-36324242 GGACTGAGGTGGTATCCAGGAGG + Intergenic
990345036 5:54863487-54863509 GGGATGGGGAGTTGTCCAGGAGG - Intergenic
992330963 5:75717191-75717213 GGTCTGGGGAAGAGCCCAGGGGG + Intronic
992741276 5:79775843-79775865 TGACTGTGGAGGGGTAAAGGAGG + Intronic
992853841 5:80839877-80839899 GGGCTGGGGAGGGTAGCAGGGGG - Intronic
993293270 5:86102230-86102252 GGCCTGCAGAGGTGTCCAGGTGG - Intergenic
994676008 5:102822898-102822920 TGAGTGGGGAGGAATCCAGGTGG - Intronic
997265091 5:132490693-132490715 GGACTGGGCACGGCTCCGGGTGG + Exonic
997287233 5:132688925-132688947 GGATGGGGGAGGGGAGCAGGTGG + Intergenic
998138819 5:139688591-139688613 GCACAGCTGAGGGGTCCAGGTGG + Intergenic
998139779 5:139693269-139693291 GGTGTGGGCAGGGGTGCAGGGGG + Intergenic
998170161 5:139868113-139868135 GCACTGGGGAGGGGCACAGTGGG + Intronic
998296183 5:140971105-140971127 GGATTGGGGTGGGCTACAGGTGG + Intronic
998372390 5:141670376-141670398 GGAATGGGCTGGGGTCCTGGGGG - Intronic
998416920 5:141952849-141952871 GGAATGGGGATGGACCCAGGAGG - Intronic
998967917 5:147560732-147560754 GGAATGTGGAGGGATCCAGAGGG - Intergenic
999143367 5:149377301-149377323 GGGGTGGGAAGGTGTCCAGGAGG - Intronic
999246749 5:150159060-150159082 GGACTGGGATGGGGTACAGTGGG + Intergenic
999249057 5:150171024-150171046 GGACTGGGGAGATGTTCACGTGG + Intronic
999365490 5:151020895-151020917 GGTCGGGGGCGGGGTCCCGGCGG - Intronic
999438335 5:151581762-151581784 GGCATGGGGAGCGGGCCAGGGGG - Intergenic
1001242950 5:170083938-170083960 GTGCAGGGGAGGGGTCCAGAAGG + Intergenic
1001470100 5:172006207-172006229 GGACCGGAGACGGGACCAGGGGG + Intronic
1001649245 5:173303719-173303741 AGTCTGGGAAGGGGTCAAGGAGG + Intergenic
1001693877 5:173654811-173654833 TGACTAGGGAGAGATCCAGGAGG - Intergenic
1001927938 5:175652665-175652687 GGGGTGGAGAGGGATCCAGGAGG - Intergenic
1002303629 5:178271204-178271226 GGAGTGGGGAGGAATCCAGCTGG + Intronic
1002545440 5:179940159-179940181 GGAATGGGCAAGGGTGCAGGTGG + Intronic
1002580875 5:180208947-180208969 GGGCTGGGGAGGGCTGCCGGCGG - Intronic
1002926633 6:1609210-1609232 CGGCTGGGGAGGGGTCATGGAGG + Intergenic
1003071585 6:2949339-2949361 GGACAGGGCAGAGGCCCAGGCGG - Intronic
1003122640 6:3330340-3330362 GGACTGTGGTGGTCTCCAGGTGG - Intronic
1004441371 6:15658443-15658465 ACACTGGGCAGGGGTGCAGGTGG + Intronic
1004445086 6:15690596-15690618 GGACTGGGGACAGGTACAGCAGG - Intergenic
1004603525 6:17173444-17173466 GGGCAGGGGAGGGGGCCAGGAGG + Intergenic
1005993789 6:30919893-30919915 GGAGAGGGGAGGGAACCAGGAGG + Intronic
1006060686 6:31416409-31416431 GGACTGGGAAGGGATGGAGGTGG + Intergenic
1006073138 6:31511296-31511318 GGACTGGGAAGGGATGGAGGTGG + Intergenic
1006116111 6:31777009-31777031 GGACTGGGGAGGGGGGCGTGGGG - Intronic
1006171954 6:32098070-32098092 TGGCTGGGGAGGGGGCCGGGGGG + Intronic
1006388019 6:33742856-33742878 GGTCTGGGAAGGAGTCCAGGAGG + Intronic
1006456862 6:34136941-34136963 GGGTTGGGGTGGGGGCCAGGCGG + Intronic
1006631954 6:35436389-35436411 TGACTTGGGAGGGGGCCACGAGG - Intergenic
1006664236 6:35678242-35678264 GGAGTGGGGAGGGGTCATGTTGG + Intronic
1006803878 6:36776443-36776465 GGAATGGGGATGGGAGCAGGAGG + Intronic
1006863173 6:37187226-37187248 GGCCTGGGGTGGGGGCCGGGGGG + Intergenic
1006911508 6:37566394-37566416 GGAGTGGGGAGGGGTCACGTGGG + Intergenic
1006945152 6:37779779-37779801 GGACGGGGGATGGGGGCAGGGGG - Intergenic
1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG + Intergenic
1007108986 6:39302140-39302162 TGACTGCAGAGGGGCCCAGGAGG + Intronic
1007139311 6:39555213-39555235 GGCTTGGGGAGGGCTCCAGGAGG - Intronic
1007312137 6:40955089-40955111 GGGCTGGGCTGGGGTCCAAGGGG - Intergenic
1007414829 6:41685127-41685149 GCCCAGGGGAGGGGTCCTGGTGG - Intronic
1007418929 6:41707655-41707677 GGGCTGGGGATGGGAACAGGTGG + Intronic
1007701785 6:43770129-43770151 GGCCGGGGGCGGGGTCCCGGCGG + Intergenic
1008415605 6:51236597-51236619 GGACAGGGGAGTGGGGCAGGGGG - Intergenic
1012180048 6:96141504-96141526 AGAAAGTGGAGGGGTCCAGGGGG + Intronic
1012873090 6:104695095-104695117 GGACTTGGGAAGGGTTCAGGTGG - Intergenic
1013060480 6:106629339-106629361 GGACAGGGCAGGGATCTAGGGGG - Exonic
1013232263 6:108169196-108169218 GGGCTGGGGCGGGGCCCAGGAGG - Intronic
1013662283 6:112309661-112309683 AGACTGGGGTGGGATCGAGGTGG - Intergenic
1015158483 6:130125051-130125073 GTACTGGAGCGGGGTCCTGGAGG + Intronic
1016461768 6:144285877-144285899 GGAATGGGGCGGGGGCCGGGAGG + Intronic
1016843163 6:148544489-148544511 GGACTGGGGAGGGCCCCACTGGG - Exonic
1017215017 6:151899226-151899248 GGACTGGGCAGCTGGCCAGGCGG + Intronic
1017215113 6:151899450-151899472 GGACTGGGCAGCTGGCCAGGCGG + Intronic
1018262436 6:161984036-161984058 GGGCTGGGGAGGGGAAAAGGAGG - Intronic
1018443517 6:163834583-163834605 GGCCTGGAGAGGGGCCCAGACGG - Intergenic
1018632616 6:165834138-165834160 TAACTGGGGAGGGCTCCATGTGG - Intronic
1018813750 6:167316423-167316445 GGTCTGGGGAGGGGTGGGGGGGG - Intergenic
1019547292 7:1584645-1584667 GGACTGGGAAGGCTTCCTGGAGG - Intergenic
1019618926 7:1980102-1980124 GGCCTGGAGAGGGGGACAGGAGG + Intronic
1019767919 7:2865128-2865150 AGAGTGGGATGGGGTCCAGGTGG + Intergenic
1019918753 7:4149798-4149820 GCAATGGGGAGGGGACCATGTGG + Intronic
1020174250 7:5869663-5869685 GGACTGGAGAAGGGTGCAGGTGG - Intergenic
1020532099 7:9350998-9351020 GGACCTGGGAGAGGGCCAGGTGG - Intergenic
1021194982 7:17665114-17665136 GGGCTGGGCAGGGAGCCAGGAGG - Intergenic
1022465972 7:30653425-30653447 GGACAGGGGAGCTGTGCAGGTGG + Exonic
1023803148 7:43852196-43852218 GGGTTGGGCAGGGGTCTAGGTGG + Intergenic
1023839876 7:44090685-44090707 GCAATGGTGAAGGGTCCAGGGGG + Intergenic
1023883535 7:44335087-44335109 GGACTGGGAAAGGGGGCAGGAGG - Intergenic
1023940386 7:44765530-44765552 GGACTGAGGGGGGCTGCAGGGGG - Exonic
1024318184 7:48040755-48040777 GGACTGGGGAGTGGTCAAAGAGG - Intronic
1025762263 7:64405629-64405651 CGAGTGGGGAGGGGGCGAGGGGG - Intergenic
1026672613 7:72403172-72403194 GGGGTGGCGCGGGGTCCAGGAGG - Intronic
1026861452 7:73792743-73792765 GGAATGGGGTGGGGGCTAGGAGG + Intergenic
1026960694 7:74405502-74405524 GGACTGGGAGGGGGGCCGGGGGG - Exonic
1028896600 7:96048478-96048500 GGTCTGGGGTGGGGCCCAGACGG - Intronic
1029021695 7:97371116-97371138 TGACTGGGTAGGGGTGAAGGAGG + Intergenic
1029084508 7:98000703-98000725 GGACTGGAGAAGGGTGCAGGTGG + Intergenic
1029211873 7:98916027-98916049 GGCCAGGGGAGGGGGGCAGGGGG - Intronic
1029237485 7:99132972-99132994 GGACTGGGGATGGGTGGATGCGG + Intronic
1029374568 7:100170143-100170165 GGCCTGGGGAGGAGTCGAAGGGG - Exonic
1029490985 7:100869798-100869820 GGACTGGGGAGGGGGATGGGAGG + Intronic
1029689923 7:102174533-102174555 GGCTTGGGGAGCGATCCAGGGGG - Intronic
1031972973 7:128077160-128077182 GGGCTGGCGAGGGGCCAAGGTGG - Intronic
1032263023 7:130351676-130351698 ATGATGGGGAGGGGTCCAGGAGG + Intronic
1032345137 7:131109947-131109969 GGACTCGGGAGGGGTGGAGGGGG - Intergenic
1032632915 7:133673061-133673083 GAACTGGGGAGGGGTGATGGTGG - Intronic
1032663481 7:134011806-134011828 GGCATGGGGAGGGGACCAGAGGG + Intronic
1032703056 7:134398863-134398885 GGACTGGGAAGGGCTGCTGGGGG + Intergenic
1034441681 7:151088854-151088876 GGTCAGGGGAGGGCTCTAGGAGG - Intronic
1034531754 7:151700365-151700387 GGTCTGGGGTGGGGGCCTGGAGG - Intronic
1034968386 7:155404953-155404975 TGAGTGGGGACGGGACCAGGTGG - Intergenic
1035022886 7:155809416-155809438 GGGCAGGGGCGGGGTGCAGGAGG - Intronic
1035669866 8:1409089-1409111 GAACTGGGCAGTGGTCCAAGGGG - Intergenic
1035669879 8:1409139-1409161 GAACTGGGCAGTGGTCCAAGGGG - Intergenic
1036208861 8:6825887-6825909 GGAGTGGCCAGAGGTCCAGGTGG + Intronic
1036217124 8:6889915-6889937 AGACTGGGGAGGGGACGGGGAGG - Intergenic
1038411075 8:27360415-27360437 GGCCTGGGCAGGGGTCAGGGAGG + Intronic
1039805186 8:40991690-40991712 TGACTGGAGAGGGTTCCAGTGGG + Intergenic
1039880471 8:41622288-41622310 GGACAGGGGAGGGCTGCAGAGGG + Exonic
1041140954 8:54818975-54818997 GGACTGGGGATGGGAAGAGGAGG + Intergenic
1041196825 8:55409046-55409068 GGAGTGGACAGGGGTCCAGGAGG + Intronic
1042464851 8:69116721-69116743 GGAGTGGGGAGGGGGCAAGCGGG + Intergenic
1042816551 8:72883644-72883666 GGATTGGGGAGGGATACTGGGGG - Intronic
1043447385 8:80332234-80332256 GGACTGGGGAGGTGGGGAGGTGG + Intergenic
1043698346 8:83251085-83251107 GCACTGGGGTGGGGTGCTGGTGG + Intergenic
1044539146 8:93390566-93390588 GGATTGCGGAGGACTCCAGGTGG - Intergenic
1046644956 8:116776079-116776101 GGTATGGGGAAGGGGCCAGGTGG - Intronic
1046768787 8:118098316-118098338 GGAGAAGGGAGGGGCCCAGGAGG - Intronic
1046872084 8:119214993-119215015 GGACTGATGAGGGGAGCAGGAGG + Intronic
1047780387 8:128106302-128106324 GGGCTGGGCAGGGGACCAGGAGG + Intergenic
1048281957 8:133112348-133112370 GGACTGTGCTGGGGCCCAGGAGG + Intronic
1048345393 8:133571542-133571564 GGGGTGGGGAGGGGACTAGGAGG - Intronic
1048555606 8:135472882-135472904 GGACAGGGGAGGGATCCTTGTGG + Intronic
1049016636 8:139924649-139924671 GGGATGGGGAGAAGTCCAGGTGG - Intronic
1049055191 8:140230852-140230874 GCACTGGGGATCGGTCCTGGAGG + Intronic
1049239164 8:141528186-141528208 GATCTGGGGAGGCTTCCAGGAGG - Intergenic
1049408740 8:142463182-142463204 GGCCTGGGGAGGGATGGAGGGGG - Intronic
1049413433 8:142484122-142484144 GGCCTGGGGTGGGGTCCCGCCGG + Intronic
1049416401 8:142497490-142497512 GGCTGGGGGAGGGGTGCAGGGGG + Intronic
1049487660 8:142874922-142874944 GGGCTGGGGAGGGGCCTGGGCGG - Intronic
1049575045 8:143386040-143386062 GGAGTGGGGAGGGGTGGGGGCGG + Intergenic
1049600246 8:143504216-143504238 GAACTGCAGAGGGGTCCTGGGGG + Intronic
1049640469 8:143712880-143712902 GGGCTGGGGTGTGGTCCAGGTGG + Intronic
1049653538 8:143787883-143787905 GGCCTGGCGACGGGGCCAGGTGG - Intergenic
1049725393 8:144143335-144143357 GGACTGGGGAGAGTATCAGGCGG + Intergenic
1049791150 8:144473289-144473311 GGACGGCGTAGGGGTGCAGGGGG - Exonic
1049850158 8:144826640-144826662 GAACGGGGCGGGGGTCCAGGAGG - Intergenic
1050290423 9:4148605-4148627 GTGATGGGTAGGGGTCCAGGTGG - Intronic
1050457073 9:5844704-5844726 GGGATGAGGAGGGGTGCAGGAGG - Intergenic
1052313174 9:27090520-27090542 GGTCTGGGGTGGGGTGGAGGTGG - Intergenic
1053004100 9:34593082-34593104 GGGTTGGGGCGGGCTCCAGGAGG + Intergenic
1053141118 9:35683250-35683272 GGTCCAGGGAGGGGACCAGGTGG + Intronic
1055977014 9:81965472-81965494 AGACAGGGCAGGGGTTCAGGAGG + Intergenic
1056800382 9:89686809-89686831 GCACTGGGGTGCAGTCCAGGAGG + Intergenic
1056932491 9:90890541-90890563 GGACTGGGGTGGGAACCAAGGGG - Intronic
1057040991 9:91847308-91847330 GGCCTAATGAGGGGTCCAGGAGG - Intronic
1057187021 9:93062676-93062698 GGCATGGGGAGGGGCTCAGGAGG + Intronic
1057187590 9:93065586-93065608 GCCCTGGGGAGGGGGCCACGTGG + Intronic
1057194900 9:93111478-93111500 GGCGTGGGGAGGCCTCCAGGGGG - Intronic
1057211052 9:93201329-93201351 GGAGTGGGGATGGGTCCAGGTGG + Intronic
1057695804 9:97322254-97322276 GGGCTGGGGAGGAGGGCAGGGGG - Intronic
1057822273 9:98341924-98341946 GGCATGGGGAGAGCTCCAGGTGG + Intronic
1058150024 9:101453418-101453440 AGACTTGGGAGGGGTCAGGGTGG + Intergenic
1059338927 9:113586506-113586528 GGACAGGGGAGGGTGCCAGTGGG - Intronic
1059375675 9:113879159-113879181 GGGCTGGGGAGGGGTGGAGGGGG + Intronic
1059424885 9:114214798-114214820 TTTCTGGCGAGGGGTCCAGGTGG + Intronic
1059433433 9:114263317-114263339 GAACTGGGGAAGTGTCTAGGTGG - Intronic
1060222444 9:121771902-121771924 CAACTGTGGCGGGGTCCAGGGGG - Intronic
1060736150 9:126067634-126067656 GGAGTGAGGAGAGGTACAGGAGG - Intergenic
1060996590 9:127877620-127877642 GACCTGGGGAGGGGTGCGGGTGG + Exonic
1061582594 9:131546633-131546655 GGTCTGGGGGGGAGTCCTGGAGG - Intergenic
1061800000 9:133108643-133108665 GGACTGGGGTGGGTGCCAGAGGG - Intronic
1062001493 9:134218101-134218123 GGGCTGGAGAGGGGTCAGGGTGG + Intergenic
1062240676 9:135536017-135536039 GGATTGGGGAGGGGAGGAGGGGG + Intergenic
1062284619 9:135767566-135767588 GGGCTGGGTTGGGGTGCAGGAGG - Intronic
1062390379 9:136331413-136331435 AGGCTGGGGAGGGGGCCAGGTGG + Intronic
1062425340 9:136503663-136503685 GGCCTGGGGATGGCTCCTGGGGG - Intronic
1186099829 X:6144279-6144301 AGAATGGAGAGGGGTCCAGAAGG + Intronic
1186943666 X:14540861-14540883 GAACTGGGGAGGGTGCAAGGTGG + Intronic
1187997613 X:24945626-24945648 GGTCTGGGGTGGGACCCAGGCGG + Intronic
1190116789 X:47630463-47630485 AGCCTGGGGAGGGATTCAGGAGG + Intergenic
1191967045 X:66770208-66770230 GTACTGGGGAGCTGTGCAGGAGG - Intergenic
1193043967 X:77033016-77033038 GGAGTGTGCAGGGGTCCAGAGGG - Intergenic
1193964508 X:87968554-87968576 GGTCTGGGATGGGGCCCAGGGGG + Intergenic
1195681762 X:107552570-107552592 GCCCTGGGGAGAGGTGCAGGGGG - Intronic
1196669095 X:118346644-118346666 GGACCTGGGAGGGGTGTAGGGGG - Intronic
1197892336 X:131279555-131279577 GGAGTGGGGAGGGGGCGGGGGGG - Intronic
1198347869 X:135776603-135776625 GAACTGGGGTGAGGTCGAGGTGG + Intergenic
1198349774 X:135793865-135793887 GAACTGGGGTGAGGTCGAGGTGG + Intergenic
1198351677 X:135811141-135811163 GAACTGGGGTGAGGTCGAGGTGG + Intergenic
1198353588 X:135828403-135828425 GAACTGGGGTGAGGTCGAGGTGG + Intergenic
1198355493 X:135845659-135845681 GAACTGGGGTGAGGTCGAGGTGG + Intergenic
1198357403 X:135862944-135862966 GAACTGGGGTGAGGTCGAGGTGG + Intergenic
1198359317 X:135880223-135880245 GAACTGGGGTGAGGTCGAGGTGG + Intergenic
1198827325 X:140713075-140713097 GGCCAGGGGAGGGGTCCTGAGGG + Intergenic
1199143167 X:144335054-144335076 GGAGGGGGGAGGGGTGGAGGGGG - Intergenic
1199762176 X:150913324-150913346 GGGCGGGGGAGGTGTCCAGGAGG - Intergenic
1200061661 X:153486442-153486464 CGAGTTGGGAGGGGGCCAGGAGG + Intronic
1200164911 X:154029455-154029477 GGACAGGGGAGGGGGCAAAGGGG - Intronic
1200216222 X:154369325-154369347 GGACTGGGGTGGGGGCCTGATGG - Intronic
1200751224 Y:6945723-6945745 GGACCAGGGAGTGGCCCAGGAGG + Intronic