ID: 1087105115

View in Genome Browser
Species Human (GRCh38)
Location 11:94400849-94400871
Sequence CGGGCCCCTTACCAAAGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087105115 Original CRISPR CGGGCCCCTTACCAAAGTGA AGG Exonic
900981160 1:6047137-6047159 CCGGCCGCTTTCCAGAGTGAGGG - Intronic
906186264 1:43864367-43864389 AGGGCCCCTAACCAAACTGCAGG + Intronic
906794473 1:48686226-48686248 AGGGCACCTAACCAAGGTGAGGG - Intronic
908751332 1:67426763-67426785 ATGGCCCCTCACAAAAGTGAGGG + Intronic
913325418 1:117623943-117623965 CCGGCCCCTTACGTCAGTGATGG + Exonic
915248639 1:154572933-154572955 CCGGCCCCTACCCAAAGTGCGGG - Intronic
1063483010 10:6393209-6393231 CAGGCCCTTCACAAAAGTGAAGG - Intergenic
1063525996 10:6786365-6786387 AGGGCCCCTTACTCAGGTGAAGG - Intergenic
1064027716 10:11861780-11861802 CTGGCCCTTTACCAAAGAGTTGG + Intronic
1071480389 10:86060946-86060968 TGCGCCCCTTTCCAAAGAGAAGG + Intronic
1076374369 10:129973260-129973282 CGGGCCCCCGACGAAAGAGAGGG - Intergenic
1078030706 11:7748403-7748425 CATGCCCCTTTCCAAAGAGAGGG + Intergenic
1081814279 11:45929795-45929817 CTGGCCCCTTGCTAAAGTGAGGG - Intronic
1083839683 11:65297149-65297171 TGGGCGCCTTACCAAAGGGCAGG + Exonic
1087069961 11:94068591-94068613 CAGGCCCCTTAGCAAAGCTAAGG + Intronic
1087105115 11:94400849-94400871 CGGGCCCCTTACCAAAGTGAAGG + Exonic
1112401802 13:99085173-99085195 CGGGCCCCTTAACACAGGGGCGG - Intronic
1116326689 14:43539315-43539337 CGGGACCCCTTCCAGAGTGAAGG + Intergenic
1118134128 14:63002812-63002834 CGTGGCCCTTTCCAAAATGATGG + Intronic
1120951504 14:90046058-90046080 TGTGCCCCTTGCCAAGGTGAGGG + Intergenic
1124884187 15:33669446-33669468 TGGGCAGCTTACCACAGTGAAGG - Exonic
1127691486 15:61401740-61401762 CAGGCCCCAGAACAAAGTGAAGG - Intergenic
1133740346 16:8646613-8646635 TGGGGCCCTCACCAGAGTGATGG - Exonic
1136277438 16:29187219-29187241 CAGGCCCCCAACAAAAGTGAGGG - Intergenic
1145405990 17:22594628-22594650 CGGCCTCCTTCCCAAAGTGCTGG - Intergenic
1148238075 17:45982742-45982764 CAGGCCCCCTAACAAAGAGATGG - Intronic
1148392308 17:47281341-47281363 AGGGCTCCTTACCAAGTTGAGGG - Intronic
1148476069 17:47929431-47929453 AAGGTCCCTTCCCAAAGTGAAGG + Intergenic
1161399493 19:4061063-4061085 CGGGACCCTGACCACAGTGGGGG - Intronic
1161883033 19:6970976-6970998 GGGGCCATTTAGCAAAGTGATGG - Intergenic
1161989712 19:7677754-7677776 CCTGCCCCTTCCCAAGGTGATGG - Intronic
1166108978 19:40611379-40611401 GGGGCCCCCTGCCAAGGTGAGGG + Exonic
1166683930 19:44783952-44783974 AGGACCCCTGACCACAGTGATGG - Intronic
924994282 2:342712-342734 CAGGCACCTCACCAAAGTGGAGG + Intergenic
925592546 2:5524880-5524902 TGGGCCCCCTAAAAAAGTGATGG - Intergenic
928313948 2:30231981-30232003 CGGAGCCCTCACCTAAGTGACGG + Intronic
936471022 2:112798633-112798655 TGGGACCTTTGCCAAAGTGAGGG + Intergenic
936659505 2:114526814-114526836 TGAAACCCTTACCAAAGTGATGG - Intronic
937298660 2:120825073-120825095 TGGTCCCCTTCCCAAAGTGCTGG + Intronic
942918673 2:181344539-181344561 CTGGCCCCATACCAAAGAAATGG + Intergenic
944011820 2:194983017-194983039 CTGGCCCCTTCCCCAAGTAAGGG - Intergenic
944982150 2:205133709-205133731 CTGGCCCTTTGCCAAAATGAGGG - Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1181310762 22:21943616-21943638 AGGGCCCCGAACCAAAGTGTTGG - Intronic
1183525833 22:38322056-38322078 CGGCCTCCTAACCAAAGTGCTGG - Intronic
950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG + Intergenic
953543324 3:43841781-43841803 AGAGCCCCTTGCCAAAGTGTTGG + Intergenic
968570371 4:1337190-1337212 CGCGCCACTTCCCAGAGTGAAGG - Intronic
970542007 4:17089329-17089351 TGACCCCCTTACCAAAGGGAGGG - Intergenic
971997554 4:33984870-33984892 CGGCCTCCTTCCCAAAGTGCTGG + Intergenic
980485865 4:133456904-133456926 GTGGCCCCTTATCAGAGTGATGG + Intergenic
990757127 5:59086001-59086023 CGGACCCCTTGCAAAAGTCAGGG - Intronic
991219560 5:64197481-64197503 CGGGTCCCTTAGCAAAATCAAGG + Intronic
1000197967 5:158978175-158978197 CTCGCCACTTCCCAAAGTGAAGG - Intronic
1004821665 6:19374278-19374300 GAGGACCCTTACCATAGTGAAGG + Intergenic
1016972675 6:149779048-149779070 CGGGCCCCGCACCAGAGTGGGGG - Intronic
1020507067 7:9004227-9004249 CAGGCCCCTTACCACAAGGAAGG + Intergenic
1025759431 7:64376339-64376361 TGAGCCCCTGACCTAAGTGATGG + Intergenic
1047377806 8:124319364-124319386 TGAGCCTCTTACCTAAGTGATGG - Intronic
1056123434 9:83511918-83511940 AGGGCCCCTTTCTGAAGTGACGG + Intronic
1061936490 9:133860560-133860582 AAGGCCCCTTCCCAAAGTCAGGG + Intronic
1199969019 X:152844956-152844978 CAGGGCCCCTACCAATGTGAAGG + Intronic