ID: 1087112627

View in Genome Browser
Species Human (GRCh38)
Location 11:94487597-94487619
Sequence TGTCTGTTACAGCACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087112627_1087112631 -7 Left 1087112627 11:94487597-94487619 CCTCCAAAGTGCTGTAACAGACA 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1087112631 11:94487613-94487635 ACAGACATTACAGGGACAATTGG 0: 1
1: 0
2: 3
3: 35
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087112627 Original CRISPR TGTCTGTTACAGCACTTTGG AGG (reversed) Intronic
905040516 1:34953207-34953229 TGTATGTTACAGAATTTTAGTGG - Intergenic
906552633 1:46678350-46678372 TATCTGCTACAGTAGTTTGGAGG + Exonic
907597347 1:55732176-55732198 AGACTGTTACTGAACTTTGGTGG + Intergenic
908265283 1:62372851-62372873 GGCCTGTTACATCATTTTGGTGG - Intergenic
908433765 1:64084740-64084762 TGTCTGTTGAAGGAGTTTGGGGG - Intronic
909424569 1:75507669-75507691 TGTCTGGTCCAGGACTTTTGGGG + Intronic
909784520 1:79594148-79594170 TGACTGTTACAGCTCTTAGGTGG - Intergenic
909962529 1:81864425-81864447 TGTCAGTAACAGCTATTTGGGGG - Intronic
910638986 1:89439928-89439950 GGCCTGTTACTGGACTTTGGTGG - Intergenic
910948219 1:92616734-92616756 GGCCTGTTACTGGACTTTGGTGG + Intronic
911405815 1:97437629-97437651 TATCTGATACAGTACTTTGGTGG - Intronic
912113568 1:106373628-106373650 TGTATGTTAGAACAATTTGGAGG - Intergenic
913563627 1:120048311-120048333 GGTCTCCAACAGCACTTTGGGGG - Intronic
913634497 1:120745266-120745288 GGTCTCCAACAGCACTTTGGGGG + Intergenic
914284222 1:146207677-146207699 GGTCTCCAACAGCACTTTGGGGG - Intronic
914545253 1:148658416-148658438 GGTCTCCAACAGCACTTTGGGGG - Intronic
914621315 1:149412263-149412285 GGTCTCCAACAGCACTTTGGGGG + Intergenic
914986647 1:152462969-152462991 TGGCTCTGCCAGCACTTTGGTGG - Intergenic
916041736 1:160967320-160967342 TGTCTTTTGCAGCAACTTGGAGG - Intergenic
917217208 1:172690867-172690889 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
918774498 1:188610793-188610815 TGCCTGTTACTGGGCTTTGGTGG + Intergenic
918815084 1:189171274-189171296 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
918870786 1:189971093-189971115 TGTCTGTCATATCACTTTAGTGG - Intergenic
919177195 1:194033550-194033572 TGTCTATTAGAGCAGTGTGGAGG - Intergenic
920197437 1:204238412-204238434 GGTCTGTTACTGGGCTTTGGTGG + Intronic
920247064 1:204596084-204596106 TCTCTGTTACTCCATTTTGGTGG + Intergenic
921946251 1:220887893-220887915 TGGCTATTTCAGCACTTTGCGGG + Intergenic
922094313 1:222429631-222429653 TGTCTTTTGCAGCAACTTGGAGG + Intergenic
922971763 1:229747667-229747689 TGTCTGCCAAAGCACTTTGTTGG + Intergenic
923778668 1:237002045-237002067 TTTCTGTCACAGCAGTTTGCTGG + Intergenic
923989765 1:239423438-239423460 TGTCTAGCACAGCACTATGGAGG + Intronic
1063350733 10:5352424-5352446 TGTCTTTTGCAGCAATATGGAGG + Intergenic
1063899904 10:10721746-10721768 AGTCAGTTACAGCACATTGGGGG + Intergenic
1064891758 10:20183030-20183052 TTTCTGTTTCAGCAACTTGGTGG + Intronic
1066186470 10:33014437-33014459 TGAGTGTTACAGCTCTTAGGGGG - Intergenic
1068873847 10:61975924-61975946 TGTCTAATTCAGCATTTTGGGGG + Intronic
1070373585 10:75808319-75808341 TGTGTTTGAAAGCACTTTGGAGG + Intronic
1071378386 10:85033403-85033425 GGCCTGTTACTGCACTTTGTTGG + Intergenic
1073446090 10:103581227-103581249 TGTCTGATCCAGCACTTGGCTGG - Intronic
1073557354 10:104465946-104465968 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
1074399483 10:113129940-113129962 TCTCTGTTCCAGCAGTTGGGCGG + Intronic
1075461513 10:122619481-122619503 TGTCTGTTGAAGCACTATGCTGG - Intronic
1077574798 11:3374575-3374597 TGTATGTGACAGCACTGTGCTGG + Intronic
1077739537 11:4830149-4830171 TCTCTGTTCCAGCACTCTGTTGG - Intronic
1078194520 11:9124573-9124595 CCTCAGTTACAGCACTTAGGTGG - Intronic
1081119421 11:39247015-39247037 GGTCAGTTTCAGAACTTTGGGGG + Intergenic
1081444168 11:43114070-43114092 TGTCTGTCACTGCACTTTTATGG - Intergenic
1087112627 11:94487597-94487619 TGTCTGTTACAGCACTTTGGAGG - Intronic
1088854175 11:113731824-113731846 TGACAGGTACAGCAATTTGGAGG - Intergenic
1089751966 11:120658323-120658345 TGTCTATAGCAGCACTCTGGTGG - Intronic
1092057681 12:5521383-5521405 TATCTTTTACAGCACTCTGAAGG + Intronic
1092093286 12:5821671-5821693 GGCCTGTTACAGGACTTTGATGG + Intronic
1092381564 12:8000959-8000981 GGTCTGTTACTGAGCTTTGGCGG + Intergenic
1095231261 12:39742826-39742848 TGTCTGTTTCTCCAATTTGGGGG - Intronic
1097930842 12:65183947-65183969 AGTCTGTTACAGGACCGTGGCGG + Intronic
1099689784 12:85938058-85938080 TGTCTGTTACTGGGCTTTGGTGG + Intergenic
1100621583 12:96281153-96281175 TGTCTGTTCCAGGACTTTCTGGG + Intronic
1101707243 12:107232017-107232039 TCTCTGTCTCCGCACTTTGGTGG + Intergenic
1102161062 12:110769341-110769363 TGCCTCTTACAGCTCTTAGGTGG + Intergenic
1107762479 13:43695341-43695363 GGTCAGTTAAAGCACTTTGATGG - Intronic
1108738978 13:53314998-53315020 TGTCTTTTGCAGAACTTGGGTGG + Intergenic
1111632782 13:90864185-90864207 TTTCTGTTTCAGCACTTTGCAGG + Intergenic
1115846789 14:37544572-37544594 TGTCTGTTGAAGCACCTTGCAGG - Intronic
1116537461 14:46051243-46051265 TGTATGTTTCAGCACATTAGTGG + Intergenic
1117034911 14:51718192-51718214 GGTCTGGTACAGCACTAGGGAGG + Intronic
1118580981 14:67297081-67297103 TGTGTGACAAAGCACTTTGGGGG + Intronic
1119059694 14:71462169-71462191 TGTCTGTTACTGGGCTTTGCTGG - Intronic
1120345743 14:83287886-83287908 TTTCTTTTACAGCACATTGTCGG + Intergenic
1122483287 14:102061468-102061490 TGACCATTCCAGCACTTTGGGGG + Intergenic
1122765053 14:104062970-104062992 TGTCTGTTCCTGGACTTTGGTGG - Intergenic
1125125528 15:36215659-36215681 AGTCTTTAACAGCAGTTTGGAGG - Intergenic
1127282650 15:57505007-57505029 TGTCTGTCCCAGCTCTTTTGAGG + Intronic
1127818118 15:62630597-62630619 TTTCTGTTACTGCTCTCTGGAGG + Intronic
1128689380 15:69711695-69711717 TCTCTTTTACAGGACTGTGGAGG - Intergenic
1128851566 15:70963007-70963029 TGTTAATTCCAGCACTTTGGGGG + Intronic
1129119150 15:73384933-73384955 TATATGTTACAGTAATTTGGGGG - Intergenic
1136178081 16:28532307-28532329 TGTCTGTTTCCCCATTTTGGGGG - Intergenic
1138732901 16:59215752-59215774 TGTCTTTTGCAGCAACTTGGGGG - Intergenic
1146246372 17:31287270-31287292 TGTATATTAAAGCACTTTGTGGG - Intronic
1146547945 17:33755226-33755248 TGCCTCTTACAGCTTTTTGGTGG - Intronic
1147820103 17:43236398-43236420 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147821414 17:43243795-43243817 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147822213 17:43248280-43248302 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147823137 17:43253726-43253748 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147823506 17:43255869-43255891 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147823908 17:43258326-43258348 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147824180 17:43259928-43259950 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147824666 17:43262765-43262787 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147825823 17:43269249-43269271 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147826995 17:43276031-43276053 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147827843 17:43280591-43280613 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147828951 17:43286751-43286773 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147830046 17:43292894-43292916 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147830990 17:43298092-43298114 TGTCTGTCTCCGCGCTTTGGTGG + Intergenic
1147834926 17:43323245-43323267 TGTCTGTCTCCGCGCTTTGGTGG - Intergenic
1148249298 17:46061508-46061530 TGTGTGTTTCATCACTTTAGGGG - Intronic
1150353674 17:64465350-64465372 TCTCTGTTTCAGAACTTTGAGGG + Intronic
1151173326 17:72266694-72266716 TGCCTGTTCCAGCCCTTAGGCGG - Intergenic
1155940711 18:31799615-31799637 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
1156279274 18:35618783-35618805 TATTTGTTTCAGCTCTTTGGAGG - Intronic
1157394421 18:47329994-47330016 AGTCTGTTCCAGCATTTTTGTGG - Intergenic
1157998502 18:52588107-52588129 GGCCTGTTACTGGACTTTGGTGG - Intronic
1158969188 18:62650601-62650623 TGTTTATTACAGCACTTCAGTGG - Intergenic
1159873751 18:73787629-73787651 TGTCTCTTGCAGCTCTTTGAAGG - Intergenic
1165260613 19:34613633-34613655 TGTTTGTCATTGCACTTTGGTGG + Intronic
1167012606 19:46818798-46818820 TGTCCGTTACAGAATTTTTGGGG + Intergenic
1167016972 19:46847473-46847495 CGCCTGATGCAGCACTTTGGGGG - Intronic
925460730 2:4060463-4060485 TGTCTATTACTGGGCTTTGGTGG + Intergenic
925797478 2:7562629-7562651 AGTATGTTACAGGACTCTGGAGG - Intergenic
926730312 2:16031129-16031151 GGTCTATGACAACACTTTGGTGG + Intergenic
927982587 2:27383698-27383720 TGTTTGTTAAAGCTCTTTTGGGG - Intronic
928309197 2:30195623-30195645 TGTGTGTCAGAGCACTTTAGAGG - Intergenic
929913116 2:46109768-46109790 TGTCTGTTACAGATCTTAGTGGG + Intronic
931795244 2:65702134-65702156 GGTCTGTCACATCACTTTGAGGG + Intergenic
931876699 2:66521272-66521294 TGTCTGTGATAGTGCTTTGGGGG + Intronic
931938359 2:67223574-67223596 TGTCAGTTAGGGCACTTTAGGGG - Intergenic
932526345 2:72473766-72473788 TGTTTGTTACTGCGGTTTGGTGG + Intronic
932751160 2:74372545-74372567 TGTCTGTGACAGGCCTTGGGTGG - Intronic
932838079 2:75056059-75056081 TGTCTATTACAGTAACTTGGGGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935064954 2:99639355-99639377 TGTCCCTCACAGCCCTTTGGTGG - Intronic
936691088 2:114889660-114889682 TTTCTGATACAGCAATTTTGGGG - Intronic
937715907 2:125032136-125032158 TGTCTTTTTCAGCAACTTGGAGG - Intergenic
937828132 2:126389893-126389915 TGCTTGTTGAAGCACTTTGGGGG + Intergenic
940527212 2:154831765-154831787 TACATGTTACAGCACTTTGCAGG + Intronic
940700731 2:157039570-157039592 TGCCTGTCCCAGCACTTTAGGGG + Intergenic
940857257 2:158739169-158739191 TGTCTTTTGCAGCAACTTGGAGG + Intergenic
941307303 2:163886238-163886260 AGTCAGTAACAGCATTTTGGAGG + Intergenic
941668020 2:168261147-168261169 TGCCTGTTACTGGGCTTTGGTGG + Intergenic
943317925 2:186412300-186412322 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
945206622 2:207339760-207339782 TGTGTGTTGCAGCACTTTGCTGG + Intergenic
945725841 2:213471476-213471498 GGTCTGTTACTGGGCTTTGGTGG - Intronic
946854161 2:223936360-223936382 TGTCTGTAAAAGGACTTTGGGGG - Intronic
1169759805 20:9079165-9079187 TGTCTGTGAAAGCACAGTGGAGG + Intronic
1171445712 20:25203074-25203096 TGTTTGTTTTAGCAGTTTGGGGG + Intronic
1171588330 20:26558321-26558343 TGTCTGTAACTGGACTTTTGGGG + Intergenic
1171717668 20:28508138-28508160 TGTCTGTAACTGGACTTTTGGGG + Intergenic
1172943262 20:38669105-38669127 TTTCAGTTACATCACATTGGTGG - Intergenic
1174355152 20:49992733-49992755 TGTCTTTCACAGCATTTTGGGGG + Intergenic
1177558641 21:22721824-22721846 TGTAAATTCCAGCACTTTGGGGG - Intergenic
1179487630 21:41720969-41720991 TGTTTGTTCCAGCACTTAGCTGG + Intergenic
949125661 3:443127-443149 TGCCTGTTACTGGGCTTTGGTGG - Intergenic
949245872 3:1924941-1924963 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
949959644 3:9301456-9301478 TGTCAGTCAAAGCACTTTGCAGG + Intronic
950765636 3:15271118-15271140 CCTCTATTCCAGCACTTTGGGGG + Intronic
950817942 3:15727067-15727089 TGTCTGTAAGAGCTCTTGGGTGG - Intronic
951621708 3:24609050-24609072 TGTCTGATTCAACAATTTGGGGG - Intergenic
951970759 3:28441847-28441869 GGTCTGTTACTGGGCTTTGGTGG - Intronic
952286965 3:31979080-31979102 TGTCAGTAACAGCATTTTGTTGG - Intronic
952486736 3:33819609-33819631 TCCTTGTTACAGTACTTTGGTGG - Intronic
956528610 3:70192164-70192186 TCGCTGTTAGGGCACTTTGGGGG - Intergenic
957247580 3:77733879-77733901 GGCCTGTTACAGAGCTTTGGTGG - Intergenic
958763472 3:98336258-98336280 AGTCTGTTAGTGTACTTTGGTGG - Intergenic
960349533 3:116575719-116575741 GGTCTGTTACTGGGCTTTGGTGG + Intronic
963326852 3:143872674-143872696 TGTTTGTTATAGCACTTTATTGG - Intergenic
963630313 3:147723238-147723260 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
965693640 3:171383871-171383893 TGTCTGTGATAGCACATTGTAGG - Intronic
966445697 3:179998577-179998599 GGTCTGTTACTGGGCTTTGGTGG + Intronic
966921082 3:184611856-184611878 TTTCTATTATAGCAGTTTGGTGG + Intronic
967055957 3:185828383-185828405 TCTCTGTTTCAGCTCTCTGGGGG - Intergenic
969100381 4:4763864-4763886 TTCCTGTCACAGGACTTTGGTGG + Intergenic
969337452 4:6520062-6520084 TGCCTGTTAAAGCGCCTTGGGGG - Intronic
969985792 4:11209257-11209279 TGTCCCTTACAGTACATTGGTGG - Intergenic
973727354 4:53789696-53789718 TGTGTGTTAGAGCTCTTTAGGGG - Intronic
974621452 4:64361184-64361206 TGTCTGCAAAAGCACTCTGGTGG - Intronic
974687918 4:65254907-65254929 TGTCTGTTATACTACCTTGGAGG - Intergenic
974746911 4:66088887-66088909 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
976803466 4:89019402-89019424 TTTTTCTTACAGCACTTAGGAGG + Intronic
977031626 4:91891425-91891447 TTTCTGTTACTGGGCTTTGGTGG + Intergenic
977466005 4:97383392-97383414 GGTCTGTTACTGGGCTTTGGTGG + Intronic
978703642 4:111678776-111678798 TTTCTATTACAACACTTTTGGGG + Intergenic
980387944 4:132111163-132111185 GGCCTGTTACTGGACTTTGGTGG - Intergenic
980804478 4:137794141-137794163 TGCCTGTACCAGCACTTTGAGGG + Intergenic
984931910 4:184855423-184855445 TGTCTGATACAGCAGTTAGCAGG - Intergenic
987578338 5:19758293-19758315 GGCCTGTTACTGGACTTTGGTGG - Intronic
993367464 5:87050937-87050959 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
994894127 5:105679814-105679836 TCTATGTTAGAACACTTTGGAGG - Intergenic
1002380381 5:178823932-178823954 TGCCTTTTACAGCAACTTGGAGG + Intergenic
1003695894 6:8406120-8406142 GGCCTGTTACAGGGCTTTGGTGG - Intergenic
1004667625 6:17763029-17763051 TGCCTTTTACAGCAAGTTGGGGG + Intronic
1008266919 6:49439269-49439291 GGCCTGTTACTGGACTTTGGTGG - Intronic
1008504880 6:52219994-52220016 TGACTGTTACTGCACACTGGTGG - Intergenic
1008914701 6:56774444-56774466 TGTTTGTTGCAGGACTTTAGAGG - Intronic
1009851923 6:69208938-69208960 GGCCTGTTACTGCGCTTTGGTGG - Intronic
1010490875 6:76475365-76475387 TGGTTGTTAAAGCATTTTGGTGG + Intergenic
1013858426 6:114604397-114604419 TGTCTTTTGCAGCAACTTGGTGG + Intergenic
1014135980 6:117890526-117890548 TTTCTGACAAAGCACTTTGGTGG + Intergenic
1015541578 6:134319645-134319667 TGTCTGTTAAAACACTTTTGGGG - Intergenic
1015772038 6:136778906-136778928 TGCCAGTGCCAGCACTTTGGGGG + Intronic
1016561978 6:145406494-145406516 TGTCTGATAAGGCACTCTGGTGG + Intergenic
1016576254 6:145572567-145572589 GGTCTGTTACTGGGCTTTGGTGG - Intronic
1020077192 7:5266106-5266128 TGTGTGTGACAGCGTTTTGGGGG + Intergenic
1021283559 7:18750671-18750693 TTTCTGATACTGCAGTTTGGAGG + Intronic
1022807653 7:33838790-33838812 TGTCTGCTAGAGCTCTTTTGTGG + Intergenic
1024840689 7:53583771-53583793 TGTCTGTTTCTGCAATGTGGGGG + Intergenic
1027005686 7:74690700-74690722 TGTCAATTACAGCACTTGGGAGG - Intronic
1028639925 7:93030261-93030283 TGTCAGCTAAAGCACTTTGTAGG - Intergenic
1030844581 7:114393357-114393379 TGTCTGTTCCAGCAGTGTGATGG + Intronic
1031332998 7:120489555-120489577 TGTCTGTGTCAGCAAGTTGGAGG - Intronic
1032728712 7:134616334-134616356 GGAGTGCTACAGCACTTTGGTGG - Intergenic
1034960518 7:155361671-155361693 TCTCTGTTGCACCACTTTGGTGG - Intronic
1035028037 7:155839145-155839167 TGTCTATGACAGCTCTTTTGTGG + Intergenic
1037178031 8:15970329-15970351 TGTGTCTTACAGCACTTGGCAGG - Intergenic
1039073630 8:33669028-33669050 TTTCTGTTACAGATCTTTTGAGG - Intergenic
1041108663 8:54466201-54466223 TATATGTAACAGCACTTTGCAGG - Intergenic
1041934556 8:63321348-63321370 GGCCTGTTACTGGACTTTGGTGG + Intergenic
1042186875 8:66145108-66145130 TGACTTTCACAGCACTTTGATGG + Intronic
1043270165 8:78323119-78323141 AGCCAGTTACAGAACTTTGGAGG - Intergenic
1043589019 8:81806232-81806254 TTTCTGTTACTGCCCTTTGTTGG - Intronic
1044150802 8:88773093-88773115 TGCCTGTTAGTGGACTTTGGTGG + Intergenic
1044199656 8:89418752-89418774 TGTCTGTTACATAACATTGTTGG - Intergenic
1044586062 8:93870076-93870098 TTACTATTACAGGACTTTGGGGG - Intronic
1044879224 8:96705641-96705663 TGTCTACTTCATCACTTTGGAGG + Intronic
1045370748 8:101520229-101520251 TCTCTGTTACACAACTTTGGAGG + Intronic
1046505007 8:115125789-115125811 TTTCTGTTGTAGCGCTTTGGTGG - Intergenic
1046829927 8:118733359-118733381 TGTCTTTTACAGCAACGTGGAGG - Intergenic
1051882150 9:21850680-21850702 GGCCTGTTACTGGACTTTGGTGG + Intronic
1052129796 9:24829260-24829282 TGTCATTTGCAGCACTTTGGAGG + Intergenic
1056819135 9:89824696-89824718 TGTTTTTGACAACACTTTGGTGG - Intergenic
1186332766 X:8553543-8553565 TTCCTGAAACAGCACTTTGGTGG - Intronic
1188535146 X:31188819-31188841 GCTCTGTTACAGCACACTGGAGG + Intronic
1191161134 X:57330850-57330872 GGTCTGTTCCAGGACTTTGCAGG + Intronic
1193558826 X:82991908-82991930 TGTCTTTTACAGGACTTGTGTGG - Intergenic
1193851618 X:86544295-86544317 TGTCTGGTACAGTATTTTGCAGG - Intronic
1194122077 X:89974333-89974355 TGTCCCTGACAGCACTTGGGAGG - Intergenic
1194522764 X:94938577-94938599 TTTCTATTAAAGCACTTGGGGGG - Intergenic
1194849242 X:98852158-98852180 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
1195331626 X:103807729-103807751 TCCCTGTCACAGCCCTTTGGGGG - Intergenic
1197378696 X:125712700-125712722 TGTCTTTTGCAGCAAATTGGAGG + Intergenic
1197409322 X:126096399-126096421 TGCCTGTTACTGAGCTTTGGTGG - Intergenic
1199097735 X:143761568-143761590 TGTCTGTTGCTGCATTTTTGTGG - Intergenic
1200474932 Y:3631769-3631791 TGTCCCTGACAGCACTTGGGAGG - Intergenic
1201302014 Y:12515962-12515984 TATCTGTTCTAGCACTTTGTGGG - Intergenic