ID: 1087113438

View in Genome Browser
Species Human (GRCh38)
Location 11:94496334-94496356
Sequence ATCTACTGGTTTAGGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087113438 Original CRISPR ATCTACTGGTTTAGGTATGA TGG (reversed) Intronic
900722333 1:4185373-4185395 ATGTAATGGTTTTGTTATGATGG + Intergenic
900828130 1:4942882-4942904 ATTTAAGGGTTTAGGAATGAGGG + Intergenic
903094575 1:20958063-20958085 CTTTCCTGGTTTAGGTATCAGGG - Intronic
906255909 1:44349998-44350020 GTCTCCTAGTTCAGGTATGATGG - Intronic
908015760 1:59833641-59833663 ATCTTCTGGTTTACGTTTCAGGG - Intronic
908862226 1:68502169-68502191 ATTTCCTGGTTTTGGTATTAGGG - Intergenic
908906077 1:69011455-69011477 ATTTTCTGGTTTTGATATGAGGG + Intergenic
909511064 1:76452756-76452778 ATTTCCTGGTTTTGGTATTAGGG + Intronic
909735300 1:78951522-78951544 ATCTACTCGTTTAGTTATTTTGG + Intronic
909828065 1:80150930-80150952 ATTTTCTGGTTTGGGTATTAGGG + Intergenic
910784851 1:90985125-90985147 ATGTGCTGGTTTAGGTTTGTGGG - Intronic
910862621 1:91757371-91757393 ATCACCTGGTTAAGGTATCATGG + Intronic
910934007 1:92471885-92471907 ATATACTGATTTTGGTATAATGG + Intergenic
913035487 1:114960831-114960853 CTCTCCTGGTTTTGGTATTAGGG + Intronic
915533560 1:156519183-156519205 TTCTACTAGTGTAGGTAAGAGGG - Intergenic
917332782 1:173899375-173899397 AAGTACTGATTTAGGTAAGAAGG - Exonic
922368737 1:224889186-224889208 ATATAGTGGTTTAGTTAGGATGG - Intergenic
922556253 1:226534686-226534708 ATCCACTCCTTTAGGTTTGATGG + Intergenic
924935068 1:248761442-248761464 CTTTACTGGTTTTGGTATTAGGG - Intergenic
1066705058 10:38168532-38168554 TTCTACTGATTTATGGATGAAGG - Intergenic
1066985423 10:42462022-42462044 TTCTACTGATTTATGGATGAAGG + Intergenic
1068924648 10:62523175-62523197 CTTTCCTGGTTTTGGTATGAGGG + Intronic
1080310030 11:30879254-30879276 ACCTACTGGCTTAAGTATGTAGG - Intronic
1082104262 11:48203388-48203410 ATTTCCTGGTTTTGGTATTAGGG - Intergenic
1084719230 11:70893418-70893440 ACCTACAGGTTTAGTTAAGAAGG + Intronic
1087113438 11:94496334-94496356 ATCTACTGGTTTAGGTATGATGG - Intronic
1089426421 11:118379891-118379913 ATCTACTGGTCAAAGTATTAGGG + Intronic
1092018099 12:5176364-5176386 ACCTAAGGATTTAGGTATGAGGG + Intergenic
1094672793 12:32587229-32587251 ATTTATTGGTTTAGGCATGAAGG + Intronic
1094802348 12:34051035-34051057 ATTTCCTGGTTTTGGTATTAGGG - Intergenic
1095115509 12:38347065-38347087 ATTTGCTGGTTTTGGTATTAGGG - Intergenic
1098852534 12:75614277-75614299 CTCTCCTGGTTTTGGTATTAGGG - Intergenic
1099397663 12:82160758-82160780 ATCTCCTGGTTCAGGCATGGTGG + Intergenic
1099687332 12:85907356-85907378 CTCTCCTGGTTTTGGTATTAGGG + Intergenic
1100203240 12:92321929-92321951 CTTTCCTGGTTTAGGTATTAGGG + Intergenic
1100213381 12:92421694-92421716 AACTCCTGGTTTAAGTCTGAAGG - Intronic
1100290686 12:93211714-93211736 CTCTCCTGGTTTTGGTATTAGGG + Intergenic
1102947784 12:117005130-117005152 ATCTTCTGTTTTGGGTAGGATGG + Intronic
1103505211 12:121438420-121438442 ATATCCTGGTTTAGTTATTATGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104690463 12:130821974-130821996 TGGTACTGCTTTAGGTATGAAGG - Intronic
1106921069 13:34563621-34563643 CTTTCCTGGTTTAGGTATTAGGG - Intergenic
1107566215 13:41607537-41607559 ACACACCGGTTTAGGTATGAAGG - Intronic
1107701620 13:43054383-43054405 ATTTCCTGGTTTTGGTATTAGGG + Intronic
1111336455 13:86831028-86831050 ATATATTGATTTAAGTATGAAGG + Intergenic
1116335803 14:43654799-43654821 ATGTCCTGGTTTTGGTATTAGGG - Intergenic
1116347052 14:43807147-43807169 ATTTCCTGGTTTTGGTATTAGGG - Intergenic
1117957702 14:61135556-61135578 ATCTAATGGTTTTGTTAGGATGG + Intergenic
1118278125 14:64404299-64404321 TTCAAATGGTTTAGGTATTAGGG - Intronic
1123766162 15:23480433-23480455 CTCTCCTGGTTTTGGTATTAGGG + Intergenic
1125956702 15:43795379-43795401 ACCAACTGGTTCAGGTAAGATGG - Exonic
1128298053 15:66541924-66541946 ATATTCTGATTTAGGTATAATGG + Intronic
1130289346 15:82583219-82583241 ATCTACTGCTTATGGTATGGGGG + Intronic
1130400076 15:83543477-83543499 TTTGACTGGTTTAGGTATCAGGG + Intronic
1130449214 15:84034113-84034135 ATCTGGTGGTTTATGGATGAGGG + Intronic
1135203144 16:20457328-20457350 CTTTTCTGGTTTGGGTATGAGGG - Intronic
1135215957 16:20570538-20570560 CTTTTCTGGTTTGGGTATGAGGG + Intronic
1139500126 16:67356309-67356331 ATCTCTTGGTTTAGCCATGATGG + Intronic
1140676077 16:77331446-77331468 ATCTCCTGGTTTAAGCAGGAGGG - Intronic
1140744581 16:77969863-77969885 ATCTACTGAATTATGTATTAGGG + Intronic
1144232664 17:13223670-13223692 ATCCACTGATTTTGGTATCAGGG - Intergenic
1147462841 17:40585576-40585598 CTCTACTGGTTTTGGTATTAGGG + Intergenic
1147517016 17:41128512-41128534 ATTTTCTGGTTTTGGTATTAGGG - Intergenic
1156564430 18:38169083-38169105 ATCCACAGATTTTGGTATGAAGG + Intergenic
1156728802 18:40164362-40164384 ATCTACTGTTTTAATAATGATGG - Intergenic
1158112250 18:53953345-53953367 ATTTCCTGGTTTTGGTATTAGGG - Intergenic
1159809558 18:73000443-73000465 ATTTTCTGGTTTATGTAGGAAGG - Intergenic
1164035246 19:21448626-21448648 ATTTACTGTCTTAGGGATGATGG + Intronic
928815372 2:35288479-35288501 ATTTCCTGGTTTTGGTATCAGGG + Intergenic
929037036 2:37703688-37703710 CTTTACTGGTTTTGGTATTAGGG + Intronic
930142917 2:47971389-47971411 ATTTCCTGGTTTTGGTATTAGGG - Intergenic
931567912 2:63635385-63635407 CTCATCTGGTTTAGGTATTAAGG - Intronic
932830453 2:74984876-74984898 AGCTAGTGGTTTAGGAATGATGG + Intergenic
933201263 2:79452308-79452330 GTCTAGTGGTTGAGGTATGAAGG - Intronic
933699875 2:85246999-85247021 ATCAACTGTTTCAGTTATGAAGG - Intronic
935533276 2:104261521-104261543 AGCTACAGGTTTATGCATGATGG - Intergenic
936701929 2:115021675-115021697 CTTCACTGGTTTAGGTATTAGGG - Intronic
937037359 2:118793190-118793212 ATCTCCTGGTTGAAGTTTGAAGG + Intergenic
937545214 2:123008714-123008736 CTTTACTGGTTTTGGTATCAGGG - Intergenic
937557112 2:123171954-123171976 ATCTTCAGATTTTGGTATGAGGG + Intergenic
938216261 2:129519338-129519360 ATTTCCTGGTTTTGGTATCAGGG + Intergenic
939456785 2:142447370-142447392 ATCCACACGTTTAGGTATGATGG - Intergenic
940365954 2:152849121-152849143 CTCTCCTGGTTTTGGTATCAGGG + Intergenic
941461471 2:165777510-165777532 ATCTACTGGTTAAAGTGTTAGGG + Intronic
941679931 2:168386746-168386768 CTTTCCTGGTTTAGGTATTAGGG - Intergenic
942146607 2:173033079-173033101 ATCTATTGGTGTAGATATGTGGG + Intronic
943133095 2:183880371-183880393 CTTTCCTGGTTTTGGTATGAAGG - Intergenic
943282854 2:185959835-185959857 ATGTCCTGGTTTTGGTATTAGGG - Intergenic
943511934 2:188836661-188836683 ATGTACTCTTTAAGGTATGAGGG - Intergenic
944029326 2:195214981-195215003 ATCTACTGGTGCAGTTATCAAGG - Intergenic
944845279 2:203661953-203661975 ATCCTCTGTTTTAGGTATCAAGG - Intergenic
945075449 2:206034262-206034284 ATGTCCTGGTTTTGGTATTAGGG - Intronic
945198637 2:207260231-207260253 ATTCACTTGTTTTGGTATGAAGG + Intergenic
945286036 2:208082866-208082888 ATTTCCTGGTTTTGGTATTAGGG - Intergenic
945334489 2:208576132-208576154 ATCATCTGGTTTTGGTATCAGGG - Intronic
948222307 2:236281104-236281126 CTTTACTGGTTTTGGTATTAGGG - Intergenic
1169806752 20:9567662-9567684 ATGCACTGTTTTAGGTGTGAGGG + Intronic
1170776516 20:19379443-19379465 TTTTACTGTTTTAGGAATGAGGG + Intronic
1173106304 20:40138474-40138496 ATCTACTGGCTTTAGTATAAAGG + Intergenic
1180251047 21:46588971-46588993 CTTTCCTGGTTTTGGTATGAGGG - Intergenic
951468094 3:23024010-23024032 CTCTCCTGGTTTTGGTATTAGGG - Intergenic
955228715 3:57080702-57080724 ATCTTCTGCTTTAGGGAGGAAGG - Intergenic
956298543 3:67742135-67742157 TTTTTCTGGTTTTGGTATGAGGG + Intergenic
958014111 3:87917884-87917906 CTTTACTGGTTTTGGTATTAGGG - Intergenic
961264432 3:125629912-125629934 CTTTACTGGTTTTGGTATTAGGG + Intergenic
961553825 3:127684143-127684165 TTCCTCTGGTTTAGGGATGATGG - Intergenic
961751783 3:129100577-129100599 AACTACTGATTAAGGTATGTAGG + Intronic
962024030 3:131528348-131528370 ATCTGCTGGCTTATCTATGATGG + Intergenic
962079854 3:132126668-132126690 ATCCCCTGGTATAGGTATTATGG - Intronic
963325704 3:143860535-143860557 ATTTATTGGTTTTGGTATTAGGG + Intergenic
965185137 3:165453513-165453535 TTTTCCTGGTTTAGGTATTAGGG - Intergenic
965459693 3:168946656-168946678 ATCTATAGGTTTAGTTATGATGG - Intergenic
965662997 3:171062052-171062074 ATCTAGTGGTTTGGGCAAGATGG - Exonic
967559188 3:190898195-190898217 CTTTACTGGTTTTGGTATTAGGG - Intergenic
968891385 4:3371060-3371082 AACTACTAGTTTAGAGATGAGGG + Intronic
970217167 4:13771681-13771703 CTTTCCTGGTTTAGGTATTAGGG + Intergenic
970606750 4:17688523-17688545 ATCTCCTGTTTTAGGTTTTAAGG - Exonic
971062022 4:22982777-22982799 ATTTCCTGGTTTTGGTATCAGGG - Intergenic
971721456 4:30250292-30250314 CTTTCCTGGTTTTGGTATGAGGG + Intergenic
972934164 4:44111365-44111387 TTTTTCTGGTTTAGGTATCAGGG + Intergenic
976691573 4:87873108-87873130 ATCTATAGCTTTAGGTAAGATGG - Intergenic
979705240 4:123713031-123713053 CTTTCCTGGTTTAGGTATTAAGG - Intergenic
979773000 4:124552548-124552570 ATCTACTCTTTTAGGTTTGAGGG - Intergenic
980714638 4:136614006-136614028 ATATAGTGGTTTAGTTAGGATGG - Intergenic
980799404 4:137729750-137729772 TTCTACTGGTTTTGGTATCAAGG + Intergenic
982543815 4:156708856-156708878 ATCTACAGGGATAGGTATGCAGG - Intergenic
982649270 4:158066149-158066171 ATCTACTGGTTTAACCCTGAAGG + Intergenic
982950297 4:161686230-161686252 TTCTCCTGGTTTTGGTATTAGGG + Intronic
983641198 4:169945373-169945395 ATCATCTGGTTTAGGGGTGAAGG + Intergenic
983707875 4:170681063-170681085 ATATAATGGTTTTGTTATGATGG - Intergenic
984560532 4:181263683-181263705 TTCTACTGATTTAGGCAAGAGGG + Intergenic
986967692 5:13295192-13295214 CTTTCCTGGTTTTGGTATGAGGG - Intergenic
988411537 5:30892280-30892302 AGCTACAGGGTTAGGTATGTAGG + Intergenic
991137171 5:63195498-63195520 CTTTCCTGGTTTTGGTATGAGGG - Intergenic
991608865 5:68430018-68430040 AGCTACTGGTTTTGTGATGATGG - Intergenic
993277544 5:85879882-85879904 ATTTCCTGGTTTTGGTATTAGGG + Intergenic
993331006 5:86599765-86599787 CTCTTCTGGTTTTGGTATAAGGG - Intergenic
993470692 5:88304271-88304293 ATCTACTGTTGTAGCTATAAGGG + Intergenic
995225924 5:109700859-109700881 ATTTACTGGGTTAGGTAATATGG + Intronic
995587858 5:113667532-113667554 CTTTACTGGTTTTGGTATTAGGG - Intergenic
997060306 5:130493113-130493135 ATTTTCTGGTTTTGGTATTAAGG - Intergenic
997157537 5:131575601-131575623 ATATAGTGGTTTAGTTAGGATGG - Intronic
997497370 5:134340869-134340891 TTTTACTGGTTTGGGTATCAGGG - Intronic
998746350 5:145264162-145264184 CTTTACTGGTTTTGGTATTAGGG - Intergenic
1000635029 5:163634239-163634261 ATCCACTGGTCTGGGTATGCAGG - Intergenic
1001785951 5:174413352-174413374 ATCTTCTGTTCTAGCTATGATGG + Intergenic
1002984571 6:2176604-2176626 ATCTGCTGGTTGGGGTAGGAGGG + Intronic
1003099977 6:3169605-3169627 ATATAATGGTTTTGGTAGGATGG - Intergenic
1005930051 6:30476471-30476493 CTCTCCTGGTTTTGGTATTAGGG - Intergenic
1008100245 6:47382663-47382685 TGCTACTGGTTTGGGTATTAGGG + Intergenic
1008422858 6:51322493-51322515 ATATACTGTTTTAGGTATTGGGG - Intergenic
1010479581 6:76334853-76334875 ATTTCCTGGTTTTGGTATTAGGG + Intergenic
1011373180 6:86662223-86662245 CTTTCCTGGTTTAGGTATTAGGG + Intergenic
1011850349 6:91620031-91620053 ATTTACTTGTTTATTTATGATGG - Intergenic
1014337141 6:120150731-120150753 CTTTCCTGGTTTTGGTATGAGGG - Intergenic
1015398338 6:132760083-132760105 ATGTGCTGTTTTAGGTATAAAGG - Intronic
1020348757 7:7194651-7194673 ATTTACTGGTTTTAGTATTAGGG + Intronic
1020883147 7:13788427-13788449 ATATAATGGTTTAGGATTGATGG + Intergenic
1024058249 7:45679872-45679894 ATCACCTGGTCCAGGTATGAGGG + Intronic
1024058267 7:45679964-45679986 ATCACCTGGTCCAGGTATGAGGG + Intronic
1024789705 7:52950723-52950745 ATTTTCTGGTTTTGGTATTATGG - Intergenic
1027947835 7:84772896-84772918 AACTACTAGTCTAGGAATGAAGG + Intergenic
1028182724 7:87745294-87745316 CTTTCCTGGTTTTGGTATGAGGG + Intronic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1034114773 7:148575098-148575120 ATCGACAGCTTTAGGTATGGTGG + Intergenic
1035890322 8:3336141-3336163 TTCTACTGCCTTAGGTATGAGGG - Intronic
1039268675 8:35856272-35856294 CTTTCCTGGTTTAGGTATTAGGG - Intergenic
1040711447 8:50194146-50194168 CTTTCCTGGTTTAGGTATTAGGG + Intronic
1040808874 8:51427406-51427428 ATCTTCTGGTTTTGATATTAGGG - Intronic
1040820431 8:51550347-51550369 ATCTCCTCGTTTTGGTATTATGG - Intronic
1043537515 8:81222309-81222331 CTCTTCTGGTTTTGGTATTAGGG + Intergenic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1050629877 9:7547675-7547697 ATCTACAGATTTTGCTATGAGGG + Intergenic
1051187843 9:14479409-14479431 ATCTACAGGCTTGGGTATGGTGG + Intergenic
1054940785 9:70739142-70739164 ATTTCCTGGTTTTGGTATTAGGG - Intronic
1055846820 9:80575282-80575304 CTCTCCTGGTTTTGGTATTAAGG - Intergenic
1056478184 9:86973493-86973515 ATCTAATGGTTTATGTATATTGG - Intergenic
1058084738 9:100736547-100736569 CTTTACTGGTTTTGGTATTAGGG + Intergenic
1059974720 9:119703160-119703182 AGCTATTGGTTTAGGTAAGTAGG + Intergenic
1060233922 9:121847816-121847838 ATTATCTGGTTTAGGTATTAGGG - Intronic
1186308724 X:8293562-8293584 CTCTCCTGGTTTTGGTATTAGGG - Intergenic
1187016154 X:15331298-15331320 ATCTACAGCATTAGGAATGACGG + Exonic
1187083184 X:16013001-16013023 ATCTACTTCTTCAGGTTTGATGG - Intergenic
1187507747 X:19890263-19890285 ATCTGCTGGTTTAGGTGTAGTGG - Intergenic
1188176546 X:26997812-26997834 CTTTACTGGTTTTGGTATTAGGG + Intergenic
1190449546 X:50564714-50564736 ATCAACTGTTTTTGGCATGATGG + Intergenic
1190896984 X:54629737-54629759 CTCTCCTGGTTTTGGTATTAGGG + Intergenic
1191150661 X:57218676-57218698 CTCTCCTGGTTTTGGTATTAGGG + Intergenic
1191813874 X:65221859-65221881 ATTTCCTGGTTTTGGTATCAGGG - Intergenic
1191954465 X:66628855-66628877 CTTTCCTGGTTTAGGTATTAGGG - Intronic
1192688033 X:73327759-73327781 CTTTCCTGGTTTTGGTATGAGGG + Intergenic
1192764295 X:74126457-74126479 ATATAGTGGTTTAGTTAGGATGG + Intergenic
1192967964 X:76200106-76200128 CTTTCCTGGTTTTGGTATGAGGG + Intergenic
1193446640 X:81613262-81613284 ATTTCCTGGTTTTGGTATTAGGG + Intergenic
1193966591 X:87994825-87994847 CTATACTGGTTTTGGTATCAGGG + Intergenic
1194201259 X:90955410-90955432 CACTACTGGTTTAGGTATGAGGG + Intergenic
1194337827 X:92669896-92669918 CTTTTCTGGTTTAGGTATCAGGG - Intergenic
1195332075 X:103810831-103810853 AGGTACTGTTTGAGGTATGAAGG - Intergenic
1195829246 X:109037640-109037662 AGCTACTGGTTTAGTTACCATGG - Intergenic
1200547103 Y:4530866-4530888 CACTACTGGTTTAGGTATGAGGG + Intergenic