ID: 1087116721

View in Genome Browser
Species Human (GRCh38)
Location 11:94533394-94533416
Sequence AACAAGGTGGTGGCTAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087116721_1087116726 -1 Left 1087116721 11:94533394-94533416 CCAATTCTAGCCACCACCTTGTT No data
Right 1087116726 11:94533416-94533438 TTATGGAACTTTTTCATCACTGG No data
1087116721_1087116728 23 Left 1087116721 11:94533394-94533416 CCAATTCTAGCCACCACCTTGTT No data
Right 1087116728 11:94533440-94533462 TACTTCAAAACAGTGTTACAGGG No data
1087116721_1087116727 22 Left 1087116721 11:94533394-94533416 CCAATTCTAGCCACCACCTTGTT No data
Right 1087116727 11:94533439-94533461 CTACTTCAAAACAGTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087116721 Original CRISPR AACAAGGTGGTGGCTAGAAT TGG (reversed) Intergenic
No off target data available for this crispr