ID: 1087117413

View in Genome Browser
Species Human (GRCh38)
Location 11:94540618-94540640
Sequence CTGCTGTCATTGGCCAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087117413_1087117415 13 Left 1087117413 11:94540618-94540640 CCAGGTTTGGCCAATGACAGCAG No data
Right 1087117415 11:94540654-94540676 CATTTCTGATGCCTGTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087117413 Original CRISPR CTGCTGTCATTGGCCAAACC TGG (reversed) Intergenic
No off target data available for this crispr