ID: 1087117415

View in Genome Browser
Species Human (GRCh38)
Location 11:94540654-94540676
Sequence CATTTCTGATGCCTGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087117413_1087117415 13 Left 1087117413 11:94540618-94540640 CCAGGTTTGGCCAATGACAGCAG No data
Right 1087117415 11:94540654-94540676 CATTTCTGATGCCTGTTGCCAGG No data
1087117412_1087117415 14 Left 1087117412 11:94540617-94540639 CCCAGGTTTGGCCAATGACAGCA No data
Right 1087117415 11:94540654-94540676 CATTTCTGATGCCTGTTGCCAGG No data
1087117414_1087117415 3 Left 1087117414 11:94540628-94540650 CCAATGACAGCAGTCTAATTTGA No data
Right 1087117415 11:94540654-94540676 CATTTCTGATGCCTGTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087117415 Original CRISPR CATTTCTGATGCCTGTTGCC AGG Intergenic
No off target data available for this crispr