ID: 1087132078

View in Genome Browser
Species Human (GRCh38)
Location 11:94677342-94677364
Sequence GGATAATGATGGGGTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087132078_1087132085 -2 Left 1087132078 11:94677342-94677364 CCCCTTTTACCCCATCATTATCC No data
Right 1087132085 11:94677363-94677385 CCTCCATAGTGCAGCTAGAGTGG No data
1087132078_1087132089 21 Left 1087132078 11:94677342-94677364 CCCCTTTTACCCCATCATTATCC No data
Right 1087132089 11:94677386-94677408 CCTTTCTAAAAGGAAAACCCAGG No data
1087132078_1087132087 11 Left 1087132078 11:94677342-94677364 CCCCTTTTACCCCATCATTATCC No data
Right 1087132087 11:94677376-94677398 GCTAGAGTGGCCTTTCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087132078 Original CRISPR GGATAATGATGGGGTAAAAG GGG (reversed) Intergenic
No off target data available for this crispr