ID: 1087136756

View in Genome Browser
Species Human (GRCh38)
Location 11:94728938-94728960
Sequence ATCTGAAAGCTATACATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087136752_1087136756 23 Left 1087136752 11:94728892-94728914 CCCTTTTTTATATTCATTATTTA 0: 1
1: 0
2: 14
3: 284
4: 2500
Right 1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG 0: 1
1: 0
2: 0
3: 11
4: 200
1087136753_1087136756 22 Left 1087136753 11:94728893-94728915 CCTTTTTTATATTCATTATTTAT 0: 1
1: 0
2: 23
3: 323
4: 2520
Right 1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG 0: 1
1: 0
2: 0
3: 11
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087136756 Original CRISPR ATCTGAAAGCTATACATACA AGG Intronic
902789337 1:18755659-18755681 TTCTGCAAGCTATACAAGCATGG - Intergenic
903171104 1:21554354-21554376 ATATGAAATATATATATACAAGG + Intronic
903891112 1:26571356-26571378 ATTAGAAAGCTACACAGACAGGG - Intronic
908050077 1:60219812-60219834 ATATGACAGCAGTACATACAGGG - Intergenic
909693205 1:78434306-78434328 TTCTGGAAGCTAGACATTCAAGG + Intronic
913557936 1:119987614-119987636 ACCTGCAAGCTATTCGTACATGG + Intronic
915408207 1:155678684-155678706 ATCTGAAAGCTAGACCTTTAGGG - Intronic
916827315 1:168454745-168454767 TTCTGACAGATATACATATAAGG - Intergenic
917777465 1:178352824-178352846 AGCTGAAAGCCTTAAATACATGG - Intronic
919682342 1:200448136-200448158 ATCTGAAATCTATGTATACAGGG - Intergenic
921455948 1:215371693-215371715 ACCTGAAAGAAATACTTACAGGG - Intergenic
921526199 1:216221508-216221530 AACTGAAAGCCATATTTACATGG + Intronic
922999567 1:229995551-229995573 TTCTGCAAGCTGTACAAACATGG - Intergenic
923850203 1:237786033-237786055 ATATGCAAACTATACATACTCGG - Exonic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924287529 1:242503418-242503440 TTCTGCAAGCTGTACAAACATGG - Intronic
1063565334 10:7168460-7168482 TTCTGATAGCTAAAGATACAAGG - Intronic
1063862970 10:10332455-10332477 ATCTGAAGGCCAGACATCCAAGG + Intergenic
1065270977 10:24033702-24033724 ATCAGAATACTATGCATACATGG + Intronic
1065417348 10:25502758-25502780 ATGTGAAAGGTACACATGCAGGG - Intronic
1067471103 10:46538652-46538674 AACATAAAACTATACATACAAGG + Intergenic
1068002289 10:51349805-51349827 AGCTTAAAGATACACATACATGG - Intronic
1068444356 10:57102283-57102305 ATCATAAATCTATACATGCAAGG + Intergenic
1069303251 10:66935461-66935483 ATGTGAAAGGTATAAATACTTGG + Intronic
1069399225 10:68024693-68024715 ATTGTATAGCTATACATACAAGG + Intronic
1070902643 10:80044170-80044192 ACCTGAAAGCTCTCCATACCTGG + Intergenic
1071418755 10:85467162-85467184 TTTTGGAAACTATACATACATGG + Intergenic
1072296811 10:94016412-94016434 ACCTTTAAGCTATACATATAAGG - Intronic
1074162928 10:110848849-110848871 ATCGTAAACCTAAACATACATGG - Intergenic
1076893978 10:133300036-133300058 AACTGAAATCTAAAAATACAAGG - Exonic
1079349764 11:19682586-19682608 TTCTGAAGGCTATACAAGCATGG + Intronic
1080313497 11:30922178-30922200 ATCTGAAAGCTCTCCCTAAAGGG + Intronic
1080452173 11:32386777-32386799 AACTGCAAGCTAAACTTACAGGG + Intergenic
1083523984 11:63344358-63344380 CTCAGAAAGCTATAAATATAAGG - Intronic
1084784112 11:71431799-71431821 ATATGAAATATATACATAAAAGG - Intronic
1086253112 11:84841126-84841148 ATTTTAAAGCTTTACATAAATGG - Intronic
1086520062 11:87659015-87659037 ATCTGAAATATATGCATAGAAGG - Intergenic
1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG + Intronic
1088548128 11:110982172-110982194 ATGTGAAAGGTACACACACATGG + Intergenic
1089000365 11:115046955-115046977 TTCGTAAAGCTATTCATACAAGG - Intergenic
1089929912 11:122299591-122299613 TTCTGCAGGCTATACAAACACGG + Intergenic
1090109833 11:123895253-123895275 ATCAGTTAGCTATACATACATGG - Intergenic
1091107083 11:132932793-132932815 ATCTGAAATCTTTACAAACTTGG + Intronic
1091816470 12:3442659-3442681 ATCTGAAAAATATACAAATAAGG - Intronic
1092613802 12:10198196-10198218 ATCTTATAGCCATACCTACAAGG - Intergenic
1093110163 12:15142363-15142385 ATCTAACAGCTATACAAACATGG + Intronic
1096910228 12:54976220-54976242 CTCTGAAAGCTCTAAATACCAGG - Intronic
1098539905 12:71642990-71643012 ACCTGAAAGCTATAAATTCTGGG + Intronic
1099808511 12:87550184-87550206 ATTTGGAAGCTGTACAAACATGG + Intergenic
1100111784 12:91254014-91254036 TTCTGAAAACTATACATATGAGG + Intergenic
1107526051 13:41232473-41232495 AACTGAAAGCAACAAATACAAGG + Intronic
1109352145 13:61196734-61196756 ATCTTAAAGATTTACACACATGG + Intergenic
1109926902 13:69154189-69154211 ATCTGAAAAGTGTACATAGATGG - Intergenic
1110241870 13:73276763-73276785 TTCTGCAGGCTATACAAACATGG - Intergenic
1111137224 13:84063781-84063803 CTCTGAAAACTATATATACACGG - Intergenic
1112755952 13:102633895-102633917 TGGTGAAAGCTAAACATACATGG - Intronic
1114774421 14:25465169-25465191 CTCTAAAAGGTATGCATACAAGG - Intergenic
1114838993 14:26240124-26240146 ATTTCAAAGGTAGACATACAAGG + Intergenic
1115684740 14:35784609-35784631 ATCTGAGAGCTATACCTTCTTGG + Intronic
1116277745 14:42858385-42858407 ACCTCATATCTATACATACATGG + Intergenic
1117465031 14:55984637-55984659 ATCTCAGAGCTATTCATGCAGGG + Intergenic
1119918440 14:78424356-78424378 ATGTGAAAGCTATTCAGCCATGG + Intronic
1120100584 14:80440582-80440604 TTTTGAAAACTATACAAACATGG + Intergenic
1120445965 14:84596827-84596849 ATCTTTAGGCTATGCATACAGGG - Intergenic
1121596630 14:95168322-95168344 ATCTGGAGGCTATACAAGCATGG - Intergenic
1122450919 14:101806606-101806628 ATATAAATGCTATAAATACAAGG - Intronic
1126907018 15:53378893-53378915 CGCTGAAAGCTTTACATATATGG - Intergenic
1127423297 15:58829980-58830002 ATCTGAGAGATATAGATACAGGG - Intronic
1128629709 15:69252291-69252313 TTCTGCAGGCTATACAAACATGG + Intronic
1130141978 15:81235273-81235295 TTCTGCAAGCTATACAAGCATGG + Intronic
1131859599 15:96638282-96638304 TTCTGAAAGTCATATATACATGG - Intergenic
1131916840 15:97275722-97275744 ATTTGACAGATATACATAGATGG + Intergenic
1133439231 16:5806717-5806739 AGCTGAAAGCTAAACAAACCTGG + Intergenic
1134402099 16:13919838-13919860 ATCTGCAAGCTACACCGACAGGG + Intergenic
1135997677 16:27264491-27264513 AACGGAAAGGTATACATATATGG + Intronic
1137957643 16:52848488-52848510 ATCAGATAGCTGTAAATACATGG + Intergenic
1138161542 16:54759302-54759324 ATCTGAACTCTATAAATACTTGG + Intergenic
1139315930 16:66068746-66068768 ATCTAAAAGCTATACATCTGGGG - Intergenic
1141142857 16:81508564-81508586 GTCTCAAAGATATATATACATGG - Intronic
1147797160 17:43052706-43052728 ATCAGGAAGCTAAAAATACACGG + Intronic
1149281663 17:55111719-55111741 TTCTGTAGGCTATACAAACATGG - Intronic
1156686799 18:39659270-39659292 ATCGGAAAGCTGTAGATGCAAGG - Intergenic
1161381638 19:3968543-3968565 ATTGGAAAACTGTACATACATGG - Intronic
1164559402 19:29278720-29278742 ATGTGTAAACTATGCATACAAGG - Intergenic
1165366121 19:35366428-35366450 ATGTGAAAGATATATATATAGGG + Intergenic
1166281858 19:41799431-41799453 ATCTGCAGGCTATACAGGCATGG - Intronic
926485164 2:13444885-13444907 ATCTGAATTCTATGAATACAAGG + Intergenic
927232496 2:20837728-20837750 ATCTTAAAAATATACAAACATGG - Intergenic
928819937 2:35348969-35348991 ATCTGAAAGCAATAAATAAATGG - Intergenic
933610902 2:84434116-84434138 TTCTGCAGGCTATACATGCATGG - Intronic
935002488 2:99033088-99033110 ATCAGAAAGCTATCCAGCCATGG - Intronic
938846326 2:135213200-135213222 ATCTGAAAGCTGTGCAAAAAAGG + Intronic
939505875 2:143046580-143046602 ATATGAAAGCAATATATATATGG + Exonic
940460981 2:153962615-153962637 TTCCCAAAGCTATACTTACATGG - Intronic
942050416 2:172134937-172134959 ATCTGACAGCTATCCATCCATGG + Intergenic
942347330 2:175017086-175017108 TTCTGCAAGCTATACAAGCATGG - Intergenic
942432613 2:175929802-175929824 ATCTCAAAGTTATATATACTGGG - Exonic
942882281 2:180875470-180875492 CTCTGGAAACTATACAAACATGG + Intergenic
942970490 2:181952368-181952390 AACTGAAAGTTATATATACTAGG + Intergenic
943275251 2:185858784-185858806 TTCTGCAGGCTATACATGCATGG + Intergenic
943895441 2:193352091-193352113 ATATATAAGCTATACACACATGG - Intergenic
944409365 2:199422963-199422985 ATCTGAAAAATTTACTTACATGG - Intronic
944816805 2:203385624-203385646 ACCTGAAAGCTAGAAATATAAGG - Intronic
945993780 2:216418462-216418484 ATCTGAAACTTAGAAATACAAGG - Intronic
946594095 2:221286788-221286810 ATCTTCAAGTTATACATACCTGG - Intergenic
948167883 2:235877250-235877272 ATTTAAAAGCTATAAAGACAAGG - Intronic
1168960518 20:1866206-1866228 ATATGATAGATATATATACATGG + Intergenic
1169859399 20:10135569-10135591 ATCTGAAAGCCATATAGATAAGG + Intergenic
1173271191 20:41536771-41536793 ATCTGTAAGGAATCCATACATGG + Intronic
1177966830 21:27738141-27738163 TTCTGCAGGCTATACATGCATGG + Intergenic
1179335774 21:40451549-40451571 TTCTGACAGCTATATATACCTGG - Intronic
1179378615 21:40877708-40877730 TTCTGCAGGCTATACAAACAGGG + Intergenic
1181812536 22:25412641-25412663 TTCTGCAAGCTGTACAAACATGG + Intergenic
950551587 3:13669398-13669420 ATCAGACACCTATACATAGAGGG - Intergenic
952385550 3:32839100-32839122 ATCAGAAATCTAAACTTACAAGG + Intronic
955905311 3:63801339-63801361 AAGTGAAAGAGATACATACACGG + Intergenic
955951532 3:64247363-64247385 ATCTGTAGCCTATAAATACATGG - Intronic
956611934 3:71132883-71132905 ATCTGATAGCTATATAGGCATGG - Intronic
956765824 3:72483522-72483544 ATGTTAAAGATATATATACAAGG - Intergenic
956899723 3:73702674-73702696 ATCTGAAAGCTGTGCCTGCATGG + Intergenic
959370923 3:105524306-105524328 ATCTGAAGGCAATAAATACTGGG - Exonic
965642387 3:170843654-170843676 TTCAGATAGCTATAGATACAGGG + Intronic
966154238 3:176898843-176898865 ATTTGGAAGCTTTATATACATGG - Intergenic
966211712 3:177460215-177460237 CTCTGAAATCTCTACATTCAAGG - Intergenic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
967474394 3:189899519-189899541 ATTTGAAATCAATACTTACAAGG + Intergenic
968386974 4:149129-149151 ATCAGAAAGTGAAACATACAAGG - Intronic
970978808 4:22073290-22073312 ATCTAAGAGTTATAAATACATGG - Intergenic
975009045 4:69325573-69325595 ATCTGAAAAGTCTACATAGAAGG - Intronic
976372498 4:84305291-84305313 ATCAGTTAGCTATAGATACATGG - Intergenic
977099643 4:92794467-92794489 ATCTGCAAGCTAGTCACACATGG - Intronic
977154962 4:93560314-93560336 TTCTGCAGGCTATACAAACATGG + Intronic
977186187 4:93940190-93940212 AACTGAAATTTATACATCCAAGG + Intergenic
977358600 4:95977632-95977654 CTGTGAAAGTTAAACATACATGG - Intergenic
977474603 4:97489725-97489747 ATTTGAAATGTAAACATACAGGG + Intronic
978111779 4:104973268-104973290 ATCTGGTAGATACACATACAGGG + Intergenic
978203997 4:106057698-106057720 TTCTGAAAGCTTTACAGAGAGGG - Intronic
979554373 4:122028110-122028132 CTCTGAAGGTTATAAATACAAGG - Intergenic
979623327 4:122819972-122819994 ATCAGAAAGCTATTCAGTCATGG + Intergenic
982518707 4:156386219-156386241 ATCTTAAACATATACAGACATGG + Intergenic
985514310 5:332091-332113 CTCTGGAAACTATACATACATGG - Intronic
986288528 5:6378807-6378829 ATCTTCAAGCAATACACACATGG + Intergenic
986874454 5:12090882-12090904 ATCACAAAGCTATGCATGCAGGG - Intergenic
987598374 5:20031877-20031899 ATCTGAAAGCTGGACAATCAAGG + Intronic
988355345 5:30166628-30166650 ATATCACAGCTATATATACATGG - Intergenic
990161656 5:52947106-52947128 TTCTGAAATTTATACATAAAGGG - Intronic
990550491 5:56872297-56872319 ATCTGGAAGGTATACATGAAGGG + Intronic
990854764 5:60252238-60252260 ATATGTAAGCTAAAAATACATGG + Intronic
992094408 5:73348381-73348403 ATCTGAAAGCTAGAGACCCAGGG + Intergenic
992345947 5:75878880-75878902 TTCTGAAAGCTGTACAAGCATGG + Intergenic
993191043 5:84681707-84681729 AACTGAAAGCTATAGAAACATGG + Intergenic
993694037 5:91038701-91038723 ATCTTAAATATATACACACAGGG + Intronic
995420122 5:111955402-111955424 ATCTAACACCTATAGATACAAGG - Intronic
996643048 5:125780524-125780546 ATCTAAAAACTATACATAATTGG - Intergenic
997744406 5:136286536-136286558 ATCAGAAGGCTATACCCACATGG - Intronic
999552509 5:152704673-152704695 ATGTGAATGTGATACATACAAGG + Intergenic
1000654588 5:163860870-163860892 ATCTTAAATAAATACATACATGG + Intergenic
1001472268 5:172022842-172022864 ATAGGAAATCAATACATACATGG - Intergenic
1001973480 5:175977140-175977162 AGCTGTAAGCTTTACATATATGG - Intronic
1002243953 5:177866641-177866663 AGCTGTAAGCTTTACATATATGG + Intergenic
1003042498 6:2700913-2700935 ATCTAAAAACTATACATCAAGGG + Intronic
1006654555 6:35579327-35579349 ATCTTAAAGGTAGACATAAAAGG - Intronic
1008113286 6:47517242-47517264 TTCTGCAAGCTATACAAGCATGG - Intronic
1008781005 6:55104886-55104908 ATCTGAAAGATATACATTTGAGG + Intergenic
1010028250 6:71244777-71244799 ATATGAAAGAAATACAGACATGG - Intergenic
1012115319 6:95289567-95289589 ATCCTAAAACTATCCATACATGG + Intergenic
1012477342 6:99628754-99628776 AGCATAAAGCTATATATACAAGG + Intergenic
1012535087 6:100286174-100286196 ATCTGTAAGGCATACATAAATGG + Intergenic
1013794307 6:113868415-113868437 ATCTGCAAGCTGTACAACCAAGG - Intergenic
1014427481 6:121326416-121326438 ATCTGACCGCTATACATGTATGG + Intronic
1014966688 6:127762034-127762056 AAATGTACGCTATACATACAAGG + Intronic
1015117701 6:129667682-129667704 AGCAGAAGGCAATACATACATGG + Intronic
1017553788 6:155541230-155541252 TTCTGAAGGCTGTACAAACATGG - Intergenic
1019231943 6:170573690-170573712 ATCCGAAAAATACACATACAAGG - Intergenic
1020741815 7:12029726-12029748 ATCTGAAAACAATAATTACATGG - Intergenic
1022065145 7:26847219-26847241 ATCTATATGCTATATATACAGGG + Intronic
1022941328 7:35242925-35242947 TTCTGAAACCTATTAATACAAGG - Intronic
1023954667 7:44874783-44874805 AGGTGAAAGCCATACATTCAAGG + Intergenic
1024176826 7:46848829-46848851 ATCTGATAACTTTACATAGAAGG + Intergenic
1027731344 7:81877431-81877453 ACCTAATAGATATACATACATGG - Intergenic
1028524287 7:91766170-91766192 ATCTGCAAACTATTCATTCAAGG + Intronic
1030165488 7:106550750-106550772 ATCTGAAAAAAATACATACATGG + Intergenic
1030840296 7:114343699-114343721 ATCTCAAAGAAATACATTCAAGG - Intronic
1036005595 8:4658989-4659011 AACTGAAAACAATACATAAAGGG + Intronic
1040838698 8:51760549-51760571 ATCTCATTGCAATACATACATGG - Intronic
1041847295 8:62344412-62344434 ATTTCAAAGCTCTATATACAGGG + Intronic
1045455648 8:102376324-102376346 ATCAGAAATCTCTAAATACAAGG + Intronic
1046568657 8:115934285-115934307 ATCTGAAAGGTACACAAAAAGGG - Intergenic
1046693469 8:117311966-117311988 ATCAGAAAGCAATAAAAACAAGG + Intergenic
1047022477 8:120790206-120790228 ATCAAAAAACTAGACATACAAGG + Intronic
1048623985 8:136164289-136164311 CTCTGAGAGCCAAACATACATGG - Intergenic
1049978346 9:881478-881500 ATCTGAATCCTATATCTACATGG + Intronic
1050100384 9:2112967-2112989 AACTGAAACCTAAACAGACATGG - Intronic
1052912568 9:33896793-33896815 ATCAGAAAGCTATGAATAGATGG - Intronic
1056128595 9:83562454-83562476 ATCTGAAAGCTTAACAAAAATGG + Intergenic
1057029532 9:91764449-91764471 ATTTGAAAGTTATACATAAGTGG + Intronic
1058226130 9:102366013-102366035 ATCTTAAAGCTGGATATACAAGG + Intergenic
1058343315 9:103924834-103924856 ATATGAAATCTATAAATAAATGG + Intergenic
1060705564 9:125795871-125795893 ATATGAAAGATATAAAAACATGG + Intronic
1188983735 X:36751233-36751255 ATCTGCAAGAGATACATAGATGG - Intergenic
1191999947 X:67138967-67138989 TTTTAAAAGCTATACATAAATGG - Intergenic
1193383191 X:80841100-80841122 ATTTGCAATCTATACATATAAGG + Intergenic
1193876832 X:86871286-86871308 ATATGGAATATATACATACATGG + Intergenic
1193876834 X:86871318-86871340 ATATGGAACATATACATACATGG + Intergenic
1193876836 X:86871348-86871370 ATATGGAACATATACATACATGG + Intergenic
1193876838 X:86871382-86871404 ATATGGAACATATACATACATGG + Intergenic
1194192278 X:90852393-90852415 ATTTGAAAACTATTAATACAGGG - Intergenic
1196500768 X:116379108-116379130 ATCAGATAGCTGTACAAACATGG - Intergenic
1198010829 X:132551942-132551964 ATCTGCAAGCTGTACAAACATGG - Intergenic
1198446540 X:136723068-136723090 TTCTGGAAGTTTTACATACATGG - Intronic
1200538915 Y:4434842-4434864 ATTTGAAAACTATTAATACAGGG - Intergenic
1201369103 Y:13241221-13241243 CTGTGGAAACTATACATACATGG + Intergenic