ID: 1087137036

View in Genome Browser
Species Human (GRCh38)
Location 11:94731394-94731416
Sequence GATACTAAGGTGGTTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087137033_1087137036 -9 Left 1087137033 11:94731380-94731402 CCTTGTGGGCAGCTGATACTAAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1087137036 11:94731394-94731416 GATACTAAGGTGGTTCTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087137036 Original CRISPR GATACTAAGGTGGTTCTCAG AGG Intronic
901774559 1:11551233-11551255 GAAAATAAGGTGGGTCCCAGGGG - Intergenic
909883125 1:80905323-80905345 GATACTATGATAGTTCTCAGTGG - Intergenic
913541354 1:119823945-119823967 AATAAAAAGGTGGTTCCCAGGGG + Intergenic
917319519 1:173764989-173765011 GCAACTAAGGTGGTACCCAGGGG + Intronic
918703755 1:187636923-187636945 GATAGTAAGGTGGCTGACAGTGG - Intergenic
920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG + Intronic
924295780 1:242585807-242585829 GAAACTAAGGGGGTTCCCTGTGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065642421 10:27797740-27797762 GCTAGTAAGGTAGCTCTCAGAGG - Intergenic
1066594533 10:37035723-37035745 GTTACTCAGGTGGTTCTAACAGG + Intergenic
1072667262 10:97402832-97402854 GATTTTAAGGAGGGTCTCAGGGG - Intronic
1072734844 10:97872258-97872280 GGTACTGAGCTGCTTCTCAGTGG - Intronic
1073190338 10:101646456-101646478 GAGGCACAGGTGGTTCTCAGAGG + Intronic
1073941297 10:108701631-108701653 TAAACTAAGGTGGTTCATAGTGG + Intergenic
1075839038 10:125482314-125482336 GATACTAAAGCTGTACTCAGAGG + Intergenic
1078006315 11:7535089-7535111 GATACTGAGCTGTTTCCCAGGGG + Intronic
1079781053 11:24605876-24605898 AATAGAAAGGTGGTTATCAGAGG - Intronic
1081128622 11:39349187-39349209 GATACTCATGTGGATCCCAGGGG - Intergenic
1081710405 11:45212373-45212395 GATACTCAGGTGTTTTTCAGGGG + Intronic
1082748672 11:56995473-56995495 GTTATTGAAGTGGTTCTCAGTGG + Intergenic
1085893932 11:80614130-80614152 GTTACTCAGGTGGTTCTAACAGG - Intergenic
1086787608 11:90989974-90989996 AATACAATGGTGGTTCCCAGAGG + Intergenic
1087137036 11:94731394-94731416 GATACTAAGGTGGTTCTCAGAGG + Intronic
1092597077 12:10019030-10019052 GACACTTAGCTGGTTCACAGTGG - Intergenic
1094583307 12:31754668-31754690 GTTACTGGGATGGTTCTCAGTGG - Intergenic
1095137242 12:38620025-38620047 GATACAATAGTGGTTGTCAGGGG + Intergenic
1098870204 12:75808877-75808899 GATAGTGAGATGGTTCTCACGGG + Intergenic
1099131341 12:78836141-78836163 AAAAATAAAGTGGTTCTCAGAGG + Intergenic
1099198450 12:79647786-79647808 GATACTTAGTTGGTTATCAAAGG - Intronic
1100260159 12:92925732-92925754 CTTACTAAGGTGTTTCTCTGAGG - Intronic
1102275839 12:111581327-111581349 GTTGCTGGGGTGGTTCTCAGTGG - Intronic
1103508970 12:121461128-121461150 GTGACTAAGGTGGGTCTTAGAGG + Intronic
1104131759 12:125900485-125900507 GTTACTAAGCTTTTTCTCAGTGG + Intergenic
1104238835 12:126967018-126967040 GATGCCATTGTGGTTCTCAGTGG - Intergenic
1106784036 13:33089572-33089594 GATGCTAAGGTGATTCACTGGGG - Intergenic
1108966481 13:56311001-56311023 GATAATGAGATGGTTCTAAGAGG - Intergenic
1109890092 13:68600319-68600341 GATAGAAATGTGGTTATCAGAGG + Intergenic
1110896993 13:80766127-80766149 GATGCAAAGTTGGTTGTCAGGGG - Intergenic
1118296523 14:64575014-64575036 GATTCTAAGATGGTTCTTTGTGG + Intronic
1122777596 14:104128406-104128428 GAGACCAAAGTGGTTCTCAAAGG - Intergenic
1124182944 15:27495139-27495161 GGTAGTAAGGTGGTTCCCATGGG - Intronic
1128838660 15:70832004-70832026 AAAACGAAGGTGGTTTTCAGTGG + Exonic
1132663433 16:1071442-1071464 GTCACAAAGGGGGTTCTCAGAGG + Intergenic
1135608101 16:23840162-23840184 GATACTAAGGAACTCCTCAGTGG - Intronic
1137534769 16:49311613-49311635 GGTACAATGGTGGTTCCCAGAGG - Intergenic
1144962503 17:19053098-19053120 GCTTCTATGGTCGTTCTCAGGGG - Intergenic
1144972658 17:19121422-19121444 GCTTCTATGGTCGTTCTCAGGGG + Intergenic
1150673493 17:67223277-67223299 GATACTAAGTTGGGTCTCTAAGG + Intronic
1155071070 18:22316770-22316792 CATCCTAAGGTGGCTCGCAGTGG + Intergenic
1155454693 18:25998562-25998584 GATTCCAAGGTGGTTCTGAATGG - Intergenic
1155807119 18:30185175-30185197 GCTGCTAAAGTGGCTCTCAGAGG - Intergenic
1158494858 18:57945730-57945752 GATAACAAGGTGGGCCTCAGAGG + Intergenic
1158969818 18:62656094-62656116 GAGACTGAATTGGTTCTCAGCGG - Intergenic
1161769610 19:6224074-6224096 GACACTCAGGTGGTTTTCAGAGG - Intronic
1162655594 19:12126713-12126735 GACACTCAGGTGGTGTTCAGTGG + Intronic
1166909128 19:46138695-46138717 CAAACTAAGGTGCTTCCCAGGGG - Intergenic
1167601029 19:50454970-50454992 GAATCTTAGGTGGATCTCAGGGG - Intronic
1167985769 19:53313945-53313967 CAGACTATGGTGGTTTTCAGTGG - Intergenic
925101404 2:1249534-1249556 CATACTTAGGTGGTTCCCACCGG - Intronic
927168960 2:20352107-20352129 GAGACAAGGATGGTTCTCAGAGG - Intronic
927961971 2:27246389-27246411 GATATGAAGTTGTTTCTCAGTGG - Intergenic
931058547 2:58500789-58500811 GGTAATTATGTGGTTCTCAGTGG - Intergenic
931959906 2:67470737-67470759 AATCCCAAGGTGATTCTCAGAGG - Intergenic
934725376 2:96613735-96613757 GATCCTTAGGAGGTTTTCAGAGG - Intronic
940317390 2:152339362-152339384 GATAAGAAGGTGGTTCTGGGTGG + Intronic
948756300 2:240161459-240161481 CGCACTAAGGTGGTTTTCAGGGG - Intergenic
1169316602 20:4596497-4596519 GAAACTAAAGTGGTCCTTAGAGG - Intergenic
1170394867 20:15915296-15915318 AATAATAAGGTGGTTCTTGGTGG - Intronic
1173042441 20:39477036-39477058 GCTAATAAGGTGAGTCTCAGTGG - Intergenic
1174254342 20:49243143-49243165 GATCCTCAGGTGGCTCTGAGAGG - Intronic
1177261122 21:18731836-18731858 GAGAGTAAGATGGTTATCAGAGG - Intergenic
1180215863 21:46323646-46323668 GCTGCTGAGGTGGATCTCAGGGG - Exonic
1183167937 22:36161594-36161616 GATGCTAGGGGGCTTCTCAGGGG - Intronic
1183852417 22:40601743-40601765 GGTACTCAGGTGGATCACAGTGG - Intronic
949127608 3:465070-465092 GATACTCAGGTGATCCTCAGTGG + Intergenic
957128827 3:76197886-76197908 GATACTTATATTGTTCTCAGAGG - Intronic
961120995 3:124369789-124369811 GAGAGTAAGGTGGTTACCAGGGG - Intronic
963294902 3:143535616-143535638 GATACAAAGGTGCTTTTCACTGG + Intronic
964289977 3:155167263-155167285 AATACTATGGTGTTTGTCAGCGG + Intronic
966660565 3:182410097-182410119 GATACATAGGTGGATCACAGGGG + Intergenic
968092048 3:195904502-195904524 GGTAAAATGGTGGTTCTCAGGGG + Intronic
969301056 4:6297474-6297496 GATATTAAGTTTGTTTTCAGAGG - Intronic
971142740 4:23942301-23942323 GATACTAAGTCCTTTCTCAGAGG - Intergenic
975109559 4:70608299-70608321 GATGCTAAGATAGATCTCAGTGG - Intergenic
975432721 4:74314024-74314046 ATTACTAAGGTGGCTCTCTGAGG + Intronic
977170790 4:93759746-93759768 GATACTCATGTGGCTCTCTGGGG + Intronic
984196218 4:176660831-176660853 GAATCTAAGGCGGTGCTCAGCGG + Intergenic
987864098 5:23518893-23518915 AACACTAAGGAGGCTCTCAGAGG - Intronic
989818649 5:45766423-45766445 GCTCCTGTGGTGGTTCTCAGGGG + Intergenic
994999038 5:107103506-107103528 GTTATAAAGATGGTTCTCAGTGG - Intergenic
995491707 5:112699897-112699919 GAAGCTAAGGTGGTGCTGAGAGG - Intergenic
996522061 5:124438256-124438278 GATTCAAAGGGGTTTCTCAGAGG - Intergenic
996695670 5:126392294-126392316 CATAGTAAGGTGGATCACAGGGG + Intronic
1001616544 5:173047637-173047659 GAGATGAAGGTGGCTCTCAGCGG - Intergenic
1003019267 6:2496020-2496042 GATACAATGGGGATTCTCAGAGG + Intergenic
1004840891 6:19583944-19583966 GAAGGTAATGTGGTTCTCAGAGG + Intergenic
1006522092 6:34576686-34576708 GTTACTCGGATGGTTCTCAGTGG + Intergenic
1008321249 6:50116903-50116925 GACACGCAGGTGCTTCTCAGAGG + Intergenic
1011255736 6:85418921-85418943 GATGGTCAGGTGGTCCTCAGTGG - Intergenic
1012697916 6:102412994-102413016 GCTACTAAGGTGGCTGGCAGGGG - Intergenic
1012753800 6:103198040-103198062 GCTAAAAAAGTGGTTCTCAGTGG + Intergenic
1013436529 6:110115540-110115562 GAAACTAATGGGGTTCTGAGTGG - Intronic
1013474277 6:110493267-110493289 GATATGAAGGTGGTCATCAGTGG - Intergenic
1018345259 6:162892899-162892921 GAGGCTGAGGTGGTTCTCTGGGG - Intronic
1019499260 7:1356150-1356172 GCTTCTCAGGTGGTTCTCAAAGG + Intergenic
1020093648 7:5355637-5355659 GATACTCAGGAGGTTCAGAGGGG + Intronic
1022366342 7:29722783-29722805 GATACTAATGTAGTTGTCACTGG - Intergenic
1022727391 7:32993383-32993405 GAAAGAAAGGTGGTTGTCAGAGG - Intronic
1023714611 7:43030384-43030406 GGTGCTAAGATGGTGCTCAGTGG - Intergenic
1027991242 7:85363779-85363801 GATAGAAAGATGGTTATCAGAGG - Intergenic
1028125312 7:87105779-87105801 GTTATTGAGATGGTTCTCAGTGG + Intergenic
1030894578 7:115041595-115041617 GATACAAAGATGGTTATCATTGG - Intergenic
1031672276 7:124564243-124564265 GATCCTAAGGTGCTGCGCAGGGG + Intergenic
1033340939 7:140491782-140491804 ATTACCAAGGTGGGTCTCAGAGG - Intergenic
1039360512 8:36872083-36872105 GATGATAAGGTGTTACTCAGAGG - Intronic
1042601435 8:70503164-70503186 GTGACTGAGGTGGTTTTCAGTGG + Intergenic
1043998003 8:86843048-86843070 GATACTGAAGTAGTACTCAGTGG + Intergenic
1047135066 8:122068321-122068343 AATAATATGGTGGTTATCAGAGG - Intergenic
1047677152 8:127214826-127214848 GAGACTATGGTGCTTTTCAGAGG - Intergenic
1050043440 9:1519541-1519563 AATACAATGGTGGTTTTCAGAGG + Intergenic
1052638201 9:31129689-31129711 GAATCTAAGCTGGATCTCAGAGG - Intergenic
1053107418 9:35423471-35423493 GATAGTATGGTGGTTACCAGGGG - Intergenic
1057967862 9:99521737-99521759 AATAGAAAGGTGGTTGTCAGGGG + Intergenic
1058177985 9:101760468-101760490 CATAGAAAGGTGGTTCCCAGCGG + Intergenic
1058197078 9:101990844-101990866 AATAGAAAGGTGGTTGTCAGAGG + Intergenic
1058463215 9:105202590-105202612 ATTACAAAGGTGGTTCTCATGGG + Intergenic
1186629949 X:11338020-11338042 GACACTAGATTGGTTCTCAGGGG - Intronic
1195746108 X:108120243-108120265 GATAACAAGGTGCTGCTCAGAGG - Intronic
1198370142 X:135982298-135982320 GATGAAAAGGTGTTTCTCAGAGG + Intergenic
1199905174 X:152220461-152220483 GACATTAAGGTAGTTCCCAGTGG + Intronic
1201682062 Y:16657238-16657260 AATACAATGGTGGTACTCAGAGG + Intergenic