ID: 1087137892

View in Genome Browser
Species Human (GRCh38)
Location 11:94739232-94739254
Sequence CATGAGTTCCAGAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087137892 Original CRISPR CATGAGTTCCAGAGGACAAA TGG Intronic
900090212 1:917004-917026 CACGGGTTCCAGAGGACAGAGGG + Intergenic
900711190 1:4115484-4115506 CAAGGGTTCCAGAGAACAACTGG - Intergenic
901096601 1:6685704-6685726 GGTGGGTTCCAGAGAACAAAAGG - Intronic
901800792 1:11706799-11706821 CATGAGGTCCAGAGGAGAGGAGG + Intronic
902964482 1:19989421-19989443 CATCAGTTCTACAGGACAATTGG - Intergenic
904263447 1:29304396-29304418 GATGAGATCCAGAGTTCAAATGG - Intronic
904343940 1:29856067-29856089 AATGAGCTCCAGAGGAGACATGG + Intergenic
906379795 1:45325539-45325561 CATGAGTTCCAAAAGCCAGACGG - Intergenic
908183217 1:61626537-61626559 CTGGAGTGGCAGAGGACAAATGG + Intergenic
909352347 1:74669485-74669507 CATGAGTTCTAGAGGTGGAATGG - Intronic
909578588 1:77205392-77205414 CATGATTTCCAGATGAAATATGG + Intronic
910074062 1:83256640-83256662 CAGAAGTTCCAGAGGATGAATGG + Intergenic
910412108 1:86957321-86957343 CATGACTCTCATAGGACAAATGG + Intronic
910562189 1:88602299-88602321 CATGGGTTCAAGATGACAAAAGG + Intergenic
917678383 1:177341304-177341326 CTTGAGTTTCATAGGAAAAAAGG - Intergenic
919138603 1:193542060-193542082 CATGACTTCCAGATGGCAGATGG + Intergenic
919606167 1:199687499-199687521 CATGACTCCCAGAAGACAGATGG + Intergenic
919649204 1:200129032-200129054 ATTGAATGCCAGAGGACAAATGG - Intronic
920656806 1:207882772-207882794 CAGGAGTTAAAGAGGAGAAAAGG - Intergenic
920736164 1:208534643-208534665 GAAGAGTTCCAGAGAACAGATGG + Intergenic
921000212 1:211036433-211036455 CATAAGTTCTACAGGACAATTGG + Intronic
921736833 1:218638086-218638108 TATGCTTTCCAGAGGAGAAATGG - Intergenic
921979180 1:221236428-221236450 CAGGATTTCTAGAGAACAAAAGG - Intergenic
924091154 1:240502341-240502363 CAAGAGTTTCAGAGGAAAAAGGG - Intronic
1063289382 10:4728016-4728038 CATCAGTTCCATGGGACAATTGG + Intergenic
1063345394 10:5307225-5307247 GATGTGTTCCAGGGAACAAAGGG - Intergenic
1063606309 10:7526082-7526104 TATGACTTCCAGATGACAGACGG - Intergenic
1064907933 10:20368259-20368281 CAGCAGTTAAAGAGGACAAAGGG - Intergenic
1065490007 10:26273337-26273359 CATGACTTCATGAGGACTAATGG + Intronic
1067401077 10:45973987-45974009 TCTGAGTTTCAGAGCACAAAGGG + Intronic
1067745254 10:48930874-48930896 CATGTGTGCCAGAGAACACAGGG - Intronic
1067869432 10:49943563-49943585 TCTGAGTTTCAGAGCACAAAGGG + Intronic
1071083204 10:81837630-81837652 CAGGAGATCCAGAAGACATATGG - Intergenic
1072008537 10:91282622-91282644 CATGAGTTCCCAAGGAGAAATGG - Exonic
1072539118 10:96384914-96384936 AATGAGCTCCAGAGGGCACAGGG + Intronic
1074526559 10:114268165-114268187 CATGAGTTCCAGAGGTGGAGGGG - Intronic
1075236042 10:120729760-120729782 CATGAGTTCCCATGTACAAAGGG + Intergenic
1075489527 10:122854682-122854704 CATGTGTTCCAGATGGCAAAAGG + Intronic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1078693371 11:13604247-13604269 CATGATTTTCAGAGAACATAGGG - Intergenic
1078898042 11:15615553-15615575 CATGAATTCCTGAGAACAAAGGG + Intergenic
1080756998 11:35210724-35210746 ATGGAGGTCCAGAGGACAAAAGG - Intronic
1082751559 11:57023942-57023964 CATGTGTTACAGAAGACAAAAGG + Intergenic
1083141946 11:60729396-60729418 GATGATTTCCAGAGGCCACAGGG - Exonic
1087137892 11:94739232-94739254 CATGAGTTCCAGAGGACAAATGG + Intronic
1087852575 11:103049448-103049470 TATGAGTTACAAAGGACAACGGG + Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088995565 11:114993359-114993381 CATGAGGTCCAGAGGCTAAAGGG - Intergenic
1088997232 11:115011579-115011601 GATGAGTTGCAGTGGACAAGGGG - Intergenic
1089159122 11:116424187-116424209 AAGGACTTCCAGAGGGCAAAGGG + Intergenic
1089491393 11:118886410-118886432 TTCGAGTTCAAGAGGACAAATGG - Intronic
1089653058 11:119927441-119927463 GATGAATGCCAGAGGACAAAGGG - Intergenic
1091201072 11:133781710-133781732 CATGAGCTCCAGAGGAGGAGGGG - Intergenic
1095204670 12:39425838-39425860 CATGATTTCCTGAGGAAAATGGG - Intronic
1095977687 12:47950965-47950987 GATTAGTGCCTGAGGACAAAAGG - Intergenic
1096226931 12:49872044-49872066 AATGAGTTTCAGAGGACCCAGGG - Intronic
1096799537 12:54101000-54101022 GATGAGATCCAGAGTACAAGGGG + Intergenic
1096844547 12:54398734-54398756 CTTGGGATCCAGAGGACATAGGG + Intronic
1098177075 12:67803909-67803931 CCTGACTTCCAGACAACAAAGGG - Intergenic
1099419303 12:82435137-82435159 CATTAGTTGCAGTGGCCAAATGG + Intronic
1102880169 12:116478782-116478804 CATCAGTTCTATAGGACAATTGG + Intergenic
1103018408 12:117514065-117514087 CATGTGTTCCAGAAAGCAAAGGG - Intronic
1106138211 13:26990315-26990337 CATTCGTTCCAGAGGAGAAGTGG - Intergenic
1106947252 13:34842382-34842404 GATGAGTTCCAGTACACAAAAGG + Intergenic
1107100303 13:36583144-36583166 CATGGTCTCCAGAGGGCAAAGGG - Intergenic
1107114164 13:36728439-36728461 GATGTGTTCCAGAGAACACAGGG + Intergenic
1107405294 13:40106633-40106655 AAGGAGTTTCAGAGGAAAAAAGG + Intergenic
1107479141 13:40771064-40771086 CCGGGCTTCCAGAGGACAAAGGG + Exonic
1108772200 13:53717365-53717387 GATGAGTTACAGAGGAAAAGGGG + Intergenic
1110455100 13:75682500-75682522 CATGAGTGCCAAGGGACAGATGG + Intronic
1111608059 13:90566003-90566025 CATCAGTTCCATGGGACAACTGG - Intergenic
1111654649 13:91137072-91137094 TATGTGTTCCAGAGGGGAAAAGG - Intergenic
1111880796 13:93954655-93954677 CAAGTGTTCCACAGGACAACTGG - Intronic
1112230829 13:97587847-97587869 CATGAATTCAAGTTGACAAAGGG - Intergenic
1115898638 14:38119269-38119291 GGTGTGTTCCAGAGAACAAAAGG - Intergenic
1116372062 14:44148859-44148881 CATGATTTCCAGAGGATAAGTGG + Intergenic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1117226600 14:53667197-53667219 CCTGGGTTCCAGAGGACAGGAGG - Intergenic
1117833447 14:59777640-59777662 CAGGAGTTCCTTAGGACCAAAGG + Intronic
1118203664 14:63701390-63701412 CATGAGTTTCAGAGTGTAAATGG + Intronic
1118451104 14:65903124-65903146 CCAGAGTTCCACAGGAAAAATGG + Intergenic
1119151300 14:72362031-72362053 CATGAGTCCAAGAGGGCAAGTGG + Intronic
1119311785 14:73653044-73653066 GGTGTGTTCCAGAGAACAAAGGG + Intronic
1119672955 14:76533565-76533587 CCTGAGTTTTAAAGGACAAATGG + Intergenic
1120063924 14:80017739-80017761 CAGGAATTCCAGAGAAGAAAAGG - Intergenic
1120235861 14:81890175-81890197 CATGAAAACCAGATGACAAAAGG + Intergenic
1121439621 14:93940470-93940492 CACGAGATCCTGAGGACAAAAGG + Intronic
1121667188 14:95681459-95681481 GATGTGTTCCAGAGCACAAAGGG - Intergenic
1123453267 15:20387809-20387831 CATCAGTTCTATAGGACAATTGG + Intergenic
1123835398 15:24185866-24185888 CATGAATTCCAGATGATATAAGG + Intergenic
1123850161 15:24347227-24347249 CATGACTTCCAGATGATATAAGG + Intergenic
1123855104 15:24401780-24401802 CATGACTTCCAGATGATATAAGG + Intergenic
1123871130 15:24574723-24574745 CATGACTTCCAGATGATATAAGG + Intergenic
1124486297 15:30120142-30120164 CATCAGTTCTATAGGACAATTGG + Intergenic
1124541372 15:30589127-30589149 CATCAGTTCTATAGGACAATTGG + Intergenic
1124548023 15:30650625-30650647 CATCAGTTCTATAGGACAATTGG + Intronic
1124757286 15:32418460-32418482 CATCAGTTCTATAGGACAATTGG - Intergenic
1125355074 15:38808831-38808853 CATAGATTCCAGAAGACAAAGGG - Intergenic
1126731258 15:51685587-51685609 CAGGATTTCCAGAGCACAAGGGG - Intronic
1127966234 15:63924780-63924802 CATGAGTTCCAATGGGCAAAGGG - Intronic
1128134817 15:65255016-65255038 CATTAGTGACAGAGGACAGATGG + Intronic
1128707870 15:69850806-69850828 TTTGAATTCAAGAGGACAAAGGG - Intergenic
1131222015 15:90592687-90592709 CCTGAGTTAAAGAGGAAAAAAGG - Intronic
1132880263 16:2159013-2159035 CATGAGATACAGGGGAAAAAAGG + Intronic
1133505315 16:6406264-6406286 CATGAGTCCCAGATGACAGGAGG - Intronic
1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG + Intergenic
1134729556 16:16449749-16449771 CATGCCCTCCAGAGGACACAAGG - Intergenic
1134876753 16:17707109-17707131 TATGACTTCTAGAGGACCAATGG - Intergenic
1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG + Intergenic
1135302147 16:21339919-21339941 CATGATTTGCAGAGTACAACTGG + Intergenic
1135630612 16:24033222-24033244 CCTGAGGCCCAGAGGACAGAGGG + Intronic
1136934200 16:34443777-34443799 TATGATTTCCTGAGGACAAGGGG - Intergenic
1136970372 16:34968037-34968059 TATGATTTCCTGAGGACAAGGGG + Intergenic
1137750030 16:50854429-50854451 CATGAGGGCAAGAGGACAGAGGG + Intergenic
1137842036 16:51649733-51649755 CATGAATTCCAGAGAGGAAAGGG - Intergenic
1137903610 16:52296051-52296073 CATGTGTTTCAGAAGACAAAGGG - Intergenic
1138975583 16:62203246-62203268 GATGAGTTAGAGAGGAAAAAAGG - Intergenic
1139211954 16:65086801-65086823 CACAAGTCCCAGAGCACAAAAGG + Intronic
1140121473 16:72086523-72086545 CATGTGTCCCAGAGGAGAAGAGG - Exonic
1140181547 16:72724326-72724348 CATTATTTCCAGTGGAGAAAAGG - Intergenic
1140239503 16:73188443-73188465 CATCAGCTCGAGAGGACAAAGGG - Intergenic
1143171171 17:4931483-4931505 CATGTGTCACAGAGGCCAAAAGG + Intergenic
1143712646 17:8744946-8744968 CAGAAGTTCCTGAGGGCAAAGGG - Intronic
1145935091 17:28710688-28710710 CTTTAGTTCCAGAGGACAGGAGG + Intronic
1146131376 17:30279253-30279275 TATGAGTCCCAGAGTATAAAGGG + Intronic
1146815537 17:35939170-35939192 CATGACTAGCAGAGGAGAAATGG + Intronic
1147375543 17:40020482-40020504 CCTGAGATCAAGAGCACAAAGGG + Intronic
1148020906 17:44552883-44552905 CATGAGCTCCATAGGAACAAAGG + Intergenic
1148037704 17:44680477-44680499 CATGAGTTCCTGAAGGTAAAGGG + Intronic
1148068595 17:44892497-44892519 CATGAGTTACAGAGGTTAACTGG + Intronic
1148501661 17:48096209-48096231 CTTGAATTCCAGAGGATCAAAGG + Intronic
1149679054 17:58491745-58491767 CATGAGTTACAGACGAGAACTGG + Exonic
1150583113 17:66493393-66493415 CAGGATTTCCAGAGCAGAAAGGG - Intronic
1150642641 17:66960022-66960044 CATTATTTCTGGAGGACAAAGGG + Intergenic
1150847392 17:68673403-68673425 CAGAAATTCCAGAGGACACAGGG - Intergenic
1151944589 17:77312448-77312470 CCTGCTTTCCAGAGGACAAGTGG - Intronic
1153135747 18:1915892-1915914 AATGAGATTCAGAGAACAAAAGG + Intergenic
1157638466 18:49186827-49186849 CATCACTTTCAGAGGACATAGGG + Intronic
1159716452 18:71829532-71829554 CATATGAACCAGAGGACAAAAGG - Intergenic
1161725354 19:5925334-5925356 CATGAGGTCCACAAGACAGAGGG + Intronic
1166162154 19:40962280-40962302 GAGGAGTTCCAGAAGACCAAGGG + Intergenic
1167756792 19:51417776-51417798 CAGGAGACCCAGAGGACAACTGG - Intronic
1167769876 19:51508494-51508516 CAGGAGACCCAGAGGACAAGTGG + Intergenic
925882629 2:8365630-8365652 CATGCGATGCAGAGAACAAATGG + Intergenic
926482033 2:13411425-13411447 CATCAGTTCTATAGGACAATTGG - Intergenic
926582802 2:14649584-14649606 CAGGATATCCAGAGGACAAGAGG - Intronic
927092858 2:19725708-19725730 GGTGTGTTCCAGAGAACAAAGGG - Intergenic
927169110 2:20353402-20353424 CATGAGCTCCAGAGGAGATAGGG - Intergenic
927264178 2:21125713-21125735 AAAGAGTTCCAGAGGGTAAAAGG - Intronic
930086287 2:47499644-47499666 CATCAGTTCTATAGGACAACTGG - Intronic
930743466 2:54857344-54857366 CCTGTGGTGCAGAGGACAAAGGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932292170 2:70591021-70591043 GTTTAGTTCCAGAGGACTAAAGG - Intergenic
935978955 2:108607870-108607892 CACAATTTTCAGAGGACAAAAGG - Intronic
936097600 2:109544284-109544306 CAGAAGTTCCAGAGCACAGAAGG - Exonic
936507902 2:113122728-113122750 GGTGAGGTCCAGAGGAGAAATGG - Intronic
937434930 2:121872409-121872431 TATGAGTTCCATGGGACAATCGG + Intergenic
938809126 2:134835625-134835647 AATGAGATCCATAGGACAATAGG - Intergenic
941481578 2:166022230-166022252 CATGAATTTCAGTGGAAAAAAGG + Intronic
942098054 2:172552314-172552336 CATGAGGTTCAGAAGACAAAAGG - Intergenic
943108677 2:183579345-183579367 CATAATTTTCAGTGGACAAACGG - Intergenic
945020339 2:205564703-205564725 CATGAGATCCAGGGCACAGATGG - Intronic
946445390 2:219735427-219735449 CATGACTCCCAAAGGACATACGG + Intergenic
946703469 2:222435486-222435508 CATGGGTTCAAGTTGACAAAAGG - Intronic
1169035144 20:2444590-2444612 GATGCTTTCCAGAGAACAAAGGG + Intergenic
1169799406 20:9499732-9499754 CATGAGTTCCAGAAGATAAGTGG + Intergenic
1172749601 20:37241310-37241332 CATTAGTTCCAGAAGAAAGATGG + Exonic
1175647010 20:60683517-60683539 CATGAGTTCCCAAGGCCACACGG - Intergenic
1175721132 20:61287999-61288021 TATGAGTTCCACAGCACGAAAGG + Intronic
1177491137 21:21827964-21827986 CAAGAGGTCCTGAGGACATATGG + Intergenic
1178317226 21:31576731-31576753 CAAGAGTTCCATAGGAAAACTGG - Intergenic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1178795234 21:35737970-35737992 CATGGGGTCAAGAGGACAGATGG + Intronic
1179204695 21:39264288-39264310 CATGAGGTCCAGAAGTTAAATGG + Intronic
1179288219 21:39996277-39996299 CAGGAGGTTCAGAGGAGAAAGGG + Intergenic
1184787737 22:46680029-46680051 CCTGAGTTCCAGAAGACAGGAGG + Intergenic
1184972495 22:48036236-48036258 CATGAGTTCAAAAGGACGGACGG + Intergenic
950105722 3:10387142-10387164 TAAGAGTCCCAGAGGACATAAGG - Intronic
950668654 3:14512243-14512265 CATGGGGTCCAGAGCACAGAGGG + Intronic
952334798 3:32394393-32394415 CATGAGAAGCTGAGGACAAAAGG - Intronic
952584962 3:34880642-34880664 CAAGAGTTACAGAAGAAAAAGGG - Intergenic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
953312480 3:41892580-41892602 CATCAGTTCTATAGGACAATTGG - Intronic
955309506 3:57871338-57871360 GTTGAGTTCTAGTGGACAAAAGG + Intronic
955975095 3:64472422-64472444 AATGGGTTCCAGAGGGGAAATGG - Intergenic
957002690 3:74904902-74904924 TATGAGGACCAGAGGGCAAAGGG + Intergenic
957003872 3:74920674-74920696 CATGCGTCCCAGAGAAGAAATGG - Intergenic
957127140 3:76176072-76176094 CATGTGTCCCAAAGGACACATGG - Intronic
960943821 3:122952654-122952676 CATAAGTGTCAGAGGGCAAAAGG - Intronic
961358499 3:126353406-126353428 CATGAGGGTCAGAGGGCAAATGG - Intronic
961651040 3:128416769-128416791 AATGAGGTCCACAGCACAAAGGG + Intergenic
961989172 3:131168981-131169003 AATGATATCCAGAGAACAAAGGG + Intronic
962835961 3:139188697-139188719 GCTGAGGTCAAGAGGACAAATGG + Intronic
963389521 3:144641352-144641374 CCTGAGTTCCAGCTGAAAAATGG + Intergenic
963751024 3:149180184-149180206 CATGAGATCAAGAGGTCTAACGG - Intronic
967295684 3:187962626-187962648 GATGGGATACAGAGGACAAATGG + Intergenic
969662281 4:8537285-8537307 AATCGGTTGCAGAGGACAAAGGG + Intergenic
970848197 4:20568843-20568865 CCTGAATGCCAGAGGAGAAAAGG - Exonic
970885338 4:20981669-20981691 CATGTATTTCAGAGGAAAAAGGG + Intronic
971100721 4:23464054-23464076 TATGAGTTCCAGTTGACAAGAGG - Intergenic
973927847 4:55757816-55757838 GGTGTGTTCCAGAGAACAAAGGG - Intergenic
974504639 4:62752886-62752908 CTTGAATTCCATAGGACAGAGGG + Intergenic
975341848 4:73251151-73251173 TATGAGTTTCACAGGACAGAAGG + Intronic
976685430 4:87809226-87809248 CATGAGTTACATAGGAAAATAGG - Intronic
977492415 4:97731900-97731922 CATGGGGGCCAAAGGACAAAGGG - Intronic
977894095 4:102344915-102344937 CCTGAGATAAAGAGGACAAAGGG + Exonic
979918624 4:126471856-126471878 CTTGAGTTCTAGAGAAAAAAGGG + Intergenic
980432283 4:132717828-132717850 AATGTGTTGCAGAGAACAAAGGG - Intergenic
982102096 4:151977966-151977988 CATCAGTTCTATAGGACAACTGG + Intergenic
982532706 4:156566415-156566437 TATGACTTCGAGTGGACAAAGGG + Intergenic
983898552 4:173107721-173107743 ATTGAGTTCCAGAAGACAATAGG + Intergenic
984627055 4:182019354-182019376 CATGAGGAGCAGAGGACAAGAGG - Intergenic
985630838 5:1013220-1013242 CATGAGTCACAGAAGACAGAAGG - Intronic
986284691 5:6350714-6350736 AGGGAGTTCCTGAGGACAAAGGG + Intergenic
986427615 5:7650397-7650419 CATGAGGTCCAAAAGACCAAAGG - Intronic
986994664 5:13593233-13593255 CATGAGTTGAAGAGGAAAAGGGG + Intergenic
988676137 5:33434964-33434986 CCTGATTACAAGAGGACAAATGG - Intergenic
990253680 5:53942973-53942995 CATGACTTCAAGAGGGAAAATGG + Intronic
992266816 5:75026908-75026930 AATGAGTTCAAGAGAAGAAAGGG + Exonic
992856522 5:80867202-80867224 CATGACTTCCAGAGGAAGAGTGG + Intronic
992911497 5:81399993-81400015 CATGTGGTGCAGAGGACACATGG + Intergenic
994654233 5:102569849-102569871 TATGGGTTCAAGTGGACAAAGGG - Intergenic
995042805 5:107608544-107608566 CATGACATGCAGGGGACAAAGGG - Intronic
997719968 5:136070443-136070465 CCTGGTTTCCAGAGAACAAATGG + Intergenic
997783556 5:136685078-136685100 CCTGAGTTCCAGAAGAAAAATGG + Intergenic
998355597 5:141533190-141533212 CATGTGTTCCAGAGATGAAAGGG - Intronic
998733626 5:145109490-145109512 CATGAAATCCAGAGCACAGAAGG + Intergenic
999409884 5:151341555-151341577 CCCAAGTACCAGAGGACAAAGGG + Intronic
1000429024 5:161128763-161128785 TATGAGTTCCAGAAAAAAAAAGG - Intergenic
1003019466 6:2497151-2497173 CATGAGTTCAAGAGGTCAGGAGG + Intergenic
1004226435 6:13788916-13788938 CATGACATCCAAAGGACAAAAGG + Exonic
1005130860 6:22506154-22506176 CATGTGTGCCCGAGGAGAAAAGG + Intergenic
1005279604 6:24258924-24258946 GATGTGTTCTAGAGAACAAAGGG - Intronic
1006152367 6:31996369-31996391 CCTGGGTTCCTGAGGAAAAAGGG - Intronic
1006158668 6:32029107-32029129 CCTGGGTTCCTGAGGAAAAAGGG - Intronic
1008407953 6:51140234-51140256 CATGAATTACAAAGCACAAAAGG + Intergenic
1010176179 6:73030802-73030824 CATGGCTTTCAGAGGAGAAAAGG - Intronic
1010555298 6:77272210-77272232 AATGAGATCCAGAGCAAAAATGG - Intergenic
1010824598 6:80456829-80456851 CATGTGTTTCAGAGAAAAAAAGG + Intergenic
1011189012 6:84711464-84711486 CATGAGTTTGAGAGGCAAAATGG + Intronic
1012374768 6:98548100-98548122 TATGAATCCCAGGGGACAAATGG - Intergenic
1013969668 6:116001732-116001754 GATGCATTCCAGAGAACAAAGGG - Intronic
1014645933 6:123972791-123972813 CATGATCTCCAGAGGAGGAAAGG - Intronic
1014980944 6:127945906-127945928 CATCAGCTACAGAGTACAAAAGG + Intergenic
1017111760 6:150939346-150939368 AAAGAGTTCCAGAGGAAAATGGG + Intronic
1018254530 6:161904831-161904853 CTTGAGATGCAGAGGACAAAAGG + Intronic
1020549278 7:9580107-9580129 CATGAGTTCCAGATGACAAATGG - Intergenic
1020598844 7:10247679-10247701 CAGGAGCTGCACAGGACAAAGGG + Intergenic
1020990208 7:15186203-15186225 CATGAGTTCCAGAGAGCATTTGG + Intergenic
1021343890 7:19498668-19498690 TATGAGGTTCAGAGGAGAAATGG + Intergenic
1022538867 7:31116772-31116794 CATGCTTTCCAGGGGACAAGCGG - Intergenic
1022802469 7:33789330-33789352 CAAGAGTCCCAGAAGAGAAAGGG - Intergenic
1026366761 7:69656078-69656100 AATGAGATCCAGAAGAGAAAGGG - Intronic
1027291762 7:76721503-76721525 CAGAAGTTCCAGAGGATGAATGG + Intergenic
1027436135 7:78166488-78166510 CATGAATTTCTGAAGACAAATGG + Intronic
1027736588 7:81939962-81939984 CCTGAGATACAGAGGGCAAAAGG + Intergenic
1028842338 7:95441841-95441863 TATGATTTCCAGGGGACATAAGG - Intergenic
1030906181 7:115185811-115185833 CATGAGTTCCTTAGTATAAACGG + Intergenic
1030943928 7:115692467-115692489 ACTGAGTTTTAGAGGACAAAAGG + Intergenic
1031191666 7:118560832-118560854 AATGAATTCCATTGGACAAATGG + Intergenic
1031469927 7:122156753-122156775 GATGAATTCCAGAGGACACAGGG + Intergenic
1031575454 7:123410528-123410550 GATCAGTTCCAAAGGAAAAAAGG + Intergenic
1034327916 7:150254382-150254404 CATCAGTTCTATAGGACAATTGG - Intronic
1034765294 7:153715056-153715078 CATCAGTTCTATAGGACAATTGG + Intergenic
1035486261 7:159228627-159228649 CATGATTTCAAGAAGACAGAAGG - Intergenic
1037294793 8:17388783-17388805 TACCAGTGCCAGAGGACAAAGGG + Intronic
1038868977 8:31472639-31472661 TATGAAGTCCAGAGAACAAATGG - Intergenic
1038969820 8:32620487-32620509 CATGAGTTAAAGAGGAAAAAAGG - Intronic
1040800001 8:51329937-51329959 CTGGAGAGCCAGAGGACAAATGG + Intronic
1041133668 8:54732630-54732652 CATGAGTTCCAGAGAGAAACTGG - Intergenic
1041307420 8:56476802-56476824 CAGAAGTTCCAGAGCACAGAAGG - Intergenic
1042041840 8:64599831-64599853 GATGAGGTCCAGAGGAGGAAAGG - Intronic
1042576581 8:70227211-70227233 AATGAGTGACAGTGGACAAAAGG - Intronic
1043955869 8:86359279-86359301 CATAGGTTCCAGAAGAGAAAGGG - Intronic
1045449121 8:102302583-102302605 CAATAGTTCCTGAGTACAAAGGG - Intronic
1045477288 8:102564171-102564193 CAAGAGCTAGAGAGGACAAATGG + Intergenic
1047307896 8:123668017-123668039 CATCAGTTCTAGGGGACAATTGG + Intergenic
1048862218 8:138731935-138731957 CTTGATTTCCAGAAGAAAAAAGG - Intronic
1050567930 9:6906212-6906234 CATCAGTTCCAGAAAGCAAACGG - Intronic
1052366627 9:27619234-27619256 CATGAGTTCCTGTGGGCAATGGG + Intergenic
1056365196 9:85898030-85898052 CAGGAGTTCCAGAAAAAAAAAGG + Intergenic
1056694295 9:88833225-88833247 CTTGAGTACCTGAGCACAAAGGG - Intergenic
1059143088 9:111872907-111872929 AATGAGATCCAGTTGACAAATGG - Intergenic
1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG + Intronic
1059859776 9:118446999-118447021 CTTGAGGGCCAGGGGACAAATGG - Intergenic
1061837602 9:133339867-133339889 CATGAGCTGGAGAGGAAAAAAGG + Exonic
1062381151 9:136287260-136287282 CGTGAGTTCCAGGGGACCATCGG - Intronic
1062445384 9:136591719-136591741 CTTGTGTGCCAGAGGACAGACGG + Intergenic
1185449166 X:273713-273735 CATGAGGACCAGAGGTCACAGGG - Intergenic
1185449459 X:274894-274916 CATGAGGACCAGAGGTCACAGGG - Intergenic
1186082277 X:5945949-5945971 CATGACTTCCATAGAACCAAGGG + Intronic
1187805299 X:23113047-23113069 CATTATTTGCAGAGGACCAAAGG + Intergenic
1188612450 X:32117139-32117161 CACCAGTGCCAGACGACAAATGG + Intronic
1189972740 X:46434501-46434523 CATGAGTTCCAGGAGTCAGAAGG - Intergenic
1190441514 X:50479598-50479620 CATGAGTTCCAGGGAGGAAAAGG - Intergenic
1190633768 X:52414332-52414354 CATGAGGCCGAGAGGACAAGAGG + Intergenic
1190637740 X:52452740-52452762 CATGATATCAAGAGGACAAGAGG + Intergenic
1193760103 X:85454150-85454172 CATGAGTTCATTAGGATAAATGG + Intergenic
1194007761 X:88518224-88518246 CAAGTGTTCCAGAGGCAAAAAGG + Intergenic
1195297366 X:103492263-103492285 GGTGTGTTCCAGAGGACAAAGGG + Intergenic
1195480861 X:105343137-105343159 AATGATTTTCTGAGGACAAATGG - Intronic
1195687597 X:107600723-107600745 CCCCAGTTCCTGAGGACAAAGGG + Exonic
1197020757 X:121685145-121685167 GGTGAATTCCAGAGAACAAAGGG - Intergenic