ID: 1087138535

View in Genome Browser
Species Human (GRCh38)
Location 11:94743452-94743474
Sequence TCCCTTGGAAAGAGTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087138531_1087138535 21 Left 1087138531 11:94743408-94743430 CCTTGTTTTCATGCTATTCAGGT 0: 1
1: 1
2: 2
3: 16
4: 196
Right 1087138535 11:94743452-94743474 TCCCTTGGAAAGAGTCATGGTGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087138535 Original CRISPR TCCCTTGGAAAGAGTCATGG TGG Intronic